Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Biology and Genetics

101624 questions • Page 2007 / 2033

the reaction between NO2 and CO to produceNO and CO2 is believed to occur via tw
   the reaction between NO2 and CO to produceNO and CO2 is believed to occur via two steps: step 1: NO2 + NO2 ---> NO + NO3 step 2: NO3 + CO ----> NO2 + CO2 the experimental…
the reaserch about the termites follow the ink trail Research Question ß Hypothe
the reaserch about the termites follow the ink trail Research Question ß Hypothesis (Proposed explanation or possible answer) If… ß Experiment (Description of how the hypothesis i…
the risk of risk of the unit-dose packet until the open 1. Increasing the number
the risk of risk of the unit-dose packet until the open 1. Increasing the number of medications an indiviklual receives not only and adverse side effects, but also increases the 1…
the rock picture below is a dark magic igneous rock most of this rock is compose
the rock picture below is a dark magic igneous rock most of this rock is composed of tiny crystals but there are some much larger yellow green olive igneous mineral by using textu…
the same day, he had presented to the emergency department with abdominal pain.
the same day, he had presented to the emergency department with abdominal pain. His medical history included treated hypertension and hypercholesterolemia, previous heavy alcohol …
the same day, he had presented to the emergency department with abdominal pain.
the same day, he had presented to the emergency department with abdominal pain. His medical history included treated hypertension and hypercholesterolemia, previous heavy alcohol …
the second part of the question: 2. Information for a column packed with sand le
the second part of the question: 2. Information for a column packed with sand length of sand column: 50 cm grain size distribution shown as Curve 1 in problem 1 inside diameter of…
the second picture is for question #5 if you can\'t see the first one. thanks HO
the second picture is for question #5 if you can't see the first one. thanks HO Question 5 uses the multipotent hemopoietic stem cell image on the right. 5. a. Identify which cell…
the small ribosomal subunit. O nelther ribosomal subunit. O both ribosomal subun
the small ribosomal subunit. O nelther ribosomal subunit. O both ribosomal subunits. O the large ribosomal subunit. Ribosomes in prokaryotes and eukaryotes are: O similar in struc…
the solution process for KI in water isendothermic would you expect KI to become
the solution process for KI in water isendothermic would you expect KI to become more or less soluble astemperature increased 2) which is greater in magnetude the lattice energy f…
the spaceship intergalactica lands on the surface of the uninhabited pink planet
the spaceship intergalactica lands on the surface of the uninhabited pink planet, which orbits a rather average star in the distant garbanzo galaxy. a scouting party sets out to e…
the specific gravity of gasoline is approximately 0.70 (a) determine the mass (k
the specific gravity of gasoline is approximately 0.70 (a) determine the mass (kg) of 50.0 liters ofgasoline. (b) the mass flow rate of gasoline exiting a refinery tank is1150 kg/…
the splitting of water during photosysthesis a> release oxygen for general use i
the splitting of water during photosysthesis a> release oxygen for general use in the environment b>supplies hydrogen ions for the ATP proton gradient c>supplies''       …
the spontaneous emission of X-rays or gamma rays by an atom O heat generated as
the spontaneous emission of X-rays or gamma rays by an atom O heat generated as uranium decays into lead O the absorption of subatomic particles by an atomic nucleus. UESTION 26 A…
the statement or passage and then choose the best answer to the question. Answer
the statement or passage and then choose the best answer to the question. Answer the question on the basis of what is in the statement or passage. For marathoners, cool weather is…
the steps of transcription and translation in the appropriate order 1-11. Some o
the steps of transcription and translation in the appropriate order 1-11. Some options will not be sed. RNA polymerase binds to promoter region on DNA RNA polymerase stops adding …
the stimulus. 14. When voltage regulated Na gates are open, a) the membrane expe
the stimulus. 14. When voltage regulated Na gates are open, a) the membrane experiences an absolute refractory period; b) Na ions flow out; c) the Na/K pump temporarily deactivate…
the subject of this week’s forum is Natural Selection and Evolution. These conce
the subject of this week’s forum is Natural Selection and Evolution. These concepts are central to how the vast majority of biologists understand and interpret the natural world. …
the substances in the filtrate that need to be conserved are selectively reabsor
the substances in the filtrate that need to be conserved are selectively reabsorbed s that need to be eliminated fail to be reabsorbed Quiz: UNIT 4 LECTURE EXAM (S18) th n g subst…
the success of PCR amplification depends on many factors one being that the prim
the success of PCR amplification depends on many factors one being that the primers need to be in large excess to the template DNA to drive the reaction forward over many cycles, …
the synaptonemal complex. The synaptonemal complex is a critical component for c
the synaptonemal complex. The synaptonemal complex is a critical component for chromosome pairing, segregation, and recombination. We previously identified a novel germ cell-speci…
the system that delivers oxygen and nutrients to all cells and carbon dioxide an
the system that delivers oxygen and nutrients to all cells and carbon dioxide and waste products from all cells is called NOT WRITE ON THIS TEST!! A Digesire sre secreted te blood…
the table shows data from an experiment involving three different species of phy
the table shows data from an experiment involving three different species of phytoplankton. The objective was to determine the rate at which the concentration of dissolved oxygen …
the term metabolism refers to the collection of chemical reactions carried out b
the term metabolism refers to the collection of chemical reactions carried out by the cells of an organism-typically thousands of reactions. Each reaction is catalyzed by a specif…
the terms on the left to the appropriate blanks on the right to complete the sen
the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help denature active site induced fit substrate activation energy catalyst coenzyme 1…
the terms to their correct locations in the paragraph. Gas exchange between an o
the terms to their correct locations in the paragraph. Gas exchange between an organism and its environment provides O_2 for and removes the waste product CO_2. In humans, gas exc…
the textbook states that prices we pay for goods and services do not include the
the textbook states that prices we pay for goods and services do not include their harmful environmental costs. what does this mean? can you think of one potential benefit of incl…
the the two reactions described in questions 2 and 3. After the substrate G3P en
the the two reactions described in questions 2 and 3. After the substrate G3P enters active site, a covalent bond forms between G3P and the R group on the amino acid cysteine, whi…
the three possible explanations for why Tay-Sachs has a higher incidence in East
the three possible explanations for why Tay-Sachs has a higher incidence in Eastern Europe geneticists? What is a fourth explanation that Diamond proposes? What do you think will …
the time between inoculation and the beginning of growth is usually called the a
the time between inoculation and the beginning of growth is usually called the a. lag phase b. early log phase c. late log phase d. stationary phase e. death phase 29. A cafeteria…
the tissues in column A with the characteristics in column B. Place the letter o
the tissues in column A with the characteristics in column B. Place the letter of your choice in the space answers may be used more than once.) provided. (Some Column A . Simple c…
the topic is: Hormones and the Endocrine System (Endocrine System) Overview and
the topic is: Hormones and the Endocrine System (Endocrine System) Overview and Purpose: in this section, discuss what the endocrine system is and its purpose; then explain hormon…
the treatment of Jews in Europe is comparable to the treatment of African Americ
the treatment of Jews in Europe is comparable to the treatment of African Americans under the Jim Crow laws. According to the textbook, the Jim Crow law passed in the late 19th ce…
the triplets could sing very well , so they and friend the triplets could sing v
the triplets could sing very well , so they and friend the triplets could sing very well , so they and friend the triplets could sing very well , so they and friend Pemane ae towh…
the trophic level that obtains its energy directly from the producers of an ecos
the trophic level that obtains its energy directly from the producers of an ecosystem Question options: primary producer tertiary consumer primary consumer secondary consumer the …
the two clades of the protostomes? a. Eumetazoa and Metazoa b. Protostomia and B
the two clades of the protostomes? a. Eumetazoa and Metazoa b. Protostomia and Bilateria c. Bilateria and Deutersostomia d. Lophotrochozoa and Ecdysozoa e. Lophotrochozoa and Deut…
the two major hormones released from the stomach 6:37 PM K Back Ch 17-Study Guid
the two major hormones released from the stomach 6:37 PM K Back Ch 17-Study Guide.pdf Undo 1· Describe the physical characterbiks of whole blood 2. List the componenes of Nood. Pr…
the two suppressor mutations are not linked. Given this information, revise your
the two suppressor mutations are not linked. Given this information, revise your estimate of the minimal number of glutamine tRNA genes. (3 points) When two mutant alleles of a ge…
the type of regulation shown here? Is this operon normally on or o 19 binds to t
the type of regulation shown here? Is this operon normally on or o 19 binds to the operator, will the structural genes be transcribed or repressed? ff? If the repressor pescribe R…
the unfolded protein response, the accumulation of misfolded proteins in the ER
the unfolded protein response, the accumulation of misfolded proteins in the ER serves as a signal for the cell to do which of the following? Flag this Question 2 Macromolecules, …
the unknown protein con (14 points) This following experiment investigates the d
the unknown protein con (14 points) This following experiment investigates the determines the effect of varying th e enzyme concentration. activity of an enzyme peroxidase and of …
the vapor pressure of H 2 O with surface area of 50.0cm 2 is (greater than, less
the vapor pressure of H2O with surface area of 50.0cm2 is (greater than, less than, the same as) the vaporpressure of H2O with surface area of 5.0cm2. The vapor pressure of H2O at…
the ventral midline incision was opened. Sharp and blunt dissection was used in
the ventral midline incision was opened. Sharp and blunt dissection was used in defining the hernia sac. the hernia sac was opened adn the fascia examined. The hernia defect was s…
the vetiary facie \"tr ulate, hormone and lutencing hormone. ? t) etrogen and pr
the vetiary facie "tr ulate, hormone and lutencing hormone. ? t) etrogen and progesterane what is the primary role of mushoor's undetround "you"P Al protection C) anchoring 11. ) …
the volcanic hot spot responsible for formation of the Hawaiian island chain exi
the volcanic hot spot responsible for formation of the Hawaiian island chain exists for what reason tsdw Tot azixo ninda bnslai nsiinwaH odi to noinmot lot oldianoqes,"oqz tod" oi…
the way he thinks about the origin of species. \"Yes,\" he replied without hesit
the way he thinks about the origin of species. "Yes," he replied without hesitation, "I think it's occurring all over the place Critical Thinking 1. Did Darwin ever see evolution …
the wild type sequence of the beginning of the coding region of the rII gene of
the wild type sequence of the beginning of the coding region of the rII gene of phage T$ is shown : ATGGGGCCCGTCCATCCGTACGCCGGAATTATA The sequence of the clear plaque mutant with …
the word and in probability implies that we use the the word and in probability
the word and in probability implies that we use the the word and in probability implies that we use the the word and in probability implies that we use the the word and in probabi…
the ygen The extracts fused by l Western were amino Cisd2, further of mitochondr
the ygen The extracts fused by l Western were amino Cisd2, further of mitochondria (coo 1mM RCR We transfected which into P19 ER/sarc present Cisd2 and be 43 additio compl data of…
the ygen The extracts fused by l Western were amino Cisd2, further of mitochondr
the ygen The extracts fused by l Western were amino Cisd2, further of mitochondria (coo 1mM RCR We transfected which into P19 ER/sarc present Cisd2 and be 43 additio compl data of…