the wild type sequence of the beginning of the coding region of the rII gene of

Question

the wild type sequence of the beginning of the coding region of the rII gene of phage T$ is shown :

ATGGGGCCCGTCCATCCGTACGCCGGAATTATA

The sequence of the clear plaque mutant with a single base pair insertion is shown below:

ATGGGGACCCGTCCATCCGTACGCCGGAATTATA

how likely would you expect a single base pair deletion at each of the four numbered bases to act as a second site supressor of the single base pair insertion? give the order from most to least likely and tell why you placed in that order. Include the sequence of the N-terminal sequence of the R protein for each potential suppressor

Explanation / Answer

Thank you. You have posted a very great topic. I like this type of topics.Keep posting abou this topic.

Physician-Assistant-Guide.net brings you helpful information on physician assistant programs, physician assistant jobs, and physician assistant schools.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.