Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

DNA is converted into RNA by a process called transcription. The letters of RNA

ID: 3804301 • Letter: D

Question

DNA is converted into RNA by a process called transcription. The letters of RNA are read in groups of 3 (codons) in order to make proteins. In an RNA sequence, the three letter substring "AUG" is where protein synthesis begins - this is often referred to as start or a start codon. Protein synthesis stops when a stop codon is reached -this can be UAA, UGA, or UAG. The RNA sequence going from start to stop is known as a transcript. Suppose that we want to identify a transcript in an RNA sequence (we'll assume there is only one for our purposes here). Given an RNA sequence, we want to find the start codon, then a stop codon, and the letters in between. For example: GCAUUGCACAUGGCCCGAAUUUCAGUAAGGCA The transcript is highlighted in red: AUGGCCCGAAUUUCAGUAA Using string methods write a single line of code that will operate on a string corresponding to an RNA sequence, turn it into uppercase, and locate a transcript using the start and stop codons, providing the transcript string. Since there are 3 stop codons, we will limit this exercise to only consider UAA (you do not need to worry about the two other stop codons). Assume that your RNA sequences will have ONE start and ONE stop each, with the start codon preceeding the stop codon. A sample program would look like this: RNA = "UUACGAAGCCAUGCCCGGGCUUUACGGUAAGCCGAAGCCugaaggccgaau" start = "AUG" stop = "UAA" #transcript = YOUR CODE_HERE with this line uncommented print (transcript) The expected output would be: AUGCCCGGGCUUUACGGUAA Your answer below should be the ONE LINE of code needed to generate the correct value for the variable transcript.

Explanation / Answer

RNA = "ATTAUGADUWSSDCDSeaCIASKUAA"
START = 'AUG'
STOP = ['UAA','UGA','UAG']
TRANSCRIPT = RNA[RNA.find(START):RNA.find(STOP)].upper()
print(TRANSCRIPT)