Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse B

Alphabetical listing with fast deep pagination.
22495 items • Page 239 / 450

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Biochemistry: Alpha - k eratin is a very common structural protein that makes up
Biochemistry: Alpha - k eratin is a very common structural protein that makes up our nails, hair, and in other species , makes up their horns and claws. The basis of the - keratin…
Biochemistry: Can somebody please help me answer the biochemistry questions abov
Biochemistry: Can somebody please help me answer the biochemistry questions above and show your work on how did you choose it so I can understand them better? The 9 alphabets repr…
Biochemistry: Can somebody please help me answer the biochemistry questions abov
Biochemistry: Can somebody please help me answer the biochemistry questions above and show your work on how did you choose it so I can understand them better? The alphabets repres…
Biochemistry: Finding the dye concentration (µg/mL). Three dilutions were made u
Biochemistry: Finding the dye concentration (µg/mL). Three dilutions were made using a stock solution of 150 µg/mL and water. For the first dilution, 2 µL of stock was diluted wit…
Biochemistry: Ploypeptide sequence vDraw the sequence of the native polypeptide,
   Biochemistry: Ploypeptide sequence vDraw the sequence of the native polypeptide, indicating which positions might not be determined by these data. vA decapeptide has the follow…
Biochemistry: Sickle - cell anemia is a genetic blood disorder that results from
Biochemistry: Sickle - cell anemia is a genetic blood disorder that results from a point mutation in hemoglobin. Hemoglobin is a protein made of four subunits: t wo alpha chains a…
Biochemistry: The alpha helix is a regular coiled configuration of a polypeptide
Biochemistry: The alpha helix is a regular coiled configuration of a polypeptide chain with 3.6 amino acid residues per helical turn, spanning an axial distance of 0.56 nm. Each p…
Biochemistry: There are a number of different equations used to calculate the de
Biochemistry: There are a number of different equations used to calculate the deltaG of a reaction. For each equation below (5a-5c), define each term in the equation, if a number …
Biochemistry: Why might a person have elevated levels of pyruvate AND lactate? (
Biochemistry: Why might a person have elevated levels of pyruvate AND lactate? (select all answers that apply) a.) because his/her body is doing lactic acid fermentation b.) becau…
Biochemistry: Why might a person have elevated levels of pyruvate AND lactate? (
Biochemistry: Why might a person have elevated levels of pyruvate AND lactate? (select all answers that apply) a.) because his/her body is doing lactic acid fermentation b.) becau…
Biochemists frequently use “phosphate” buffers in their work. Here, “phosphate”
Biochemists frequently use “phosphate” buffers in their work. Here, “phosphate” refers generally to the class of phosphate derived ions: H2PO4- , HPO42-, PO43- . (a) Which of thes…
Biochemists have discovered more than 400 mutant varieties of hemoglobin, the bl
Biochemists have discovered more than 400 mutant varieties of hemoglobin, the blood protein that carries O_2. A sample 45.22 mg of the protein was dissolved in water at 15.0 degre…
Biochemisty The Na^+-glucose seaport system of intestinal epithelial cells coupl
Biochemisty The Na^+-glucose seaport system of intestinal epithelial cells couples the "downhill" transport of two Na^+ ions into the cell to the "uphill" transport of glucose, pu…
Biochemisty The Na^+-glucose seaport system of intestinal epithelial cells coupl
Biochemisty The Na^+-glucose seaport system of intestinal epithelial cells couples the "downhill" transport of two Na^+ ions into the cell to the "uphill" transport of glucose, pu…
Biodegradable Plastic Lab Background to its low cost and moldable Plastic is a p
Biodegradable Plastic Lab Background to its low cost and moldable Plastic is a prevalent product in most modern households due chi ains properties. Plastics are made from petroleu…
Biodegradable Plastic Lab Background: Plastic is a prevalent product in most mod
Biodegradable Plastic Lab Background: Plastic is a prevalent product in most modern households due to its low cost and moldable properties. Plastics are made from petroleum and co…
Biodegradable polymers produced from renewable monomers are particularly attract
Biodegradable polymers produced from renewable monomers are particularly attractive because they offer the promise of materials that are sustainable both in origin and disposal. W…
Biodesign suggests that the need statement should cover problem, population, and
Biodesign suggests that the need statement should cover problem, population, and outcome. Answer the following questions for each of the five statements that you need to review. A…
Biodiesel is produced from vegetable or animal oils. Usually, the glycerine in t
Biodiesel is produced from vegetable or animal oils. Usually, the glycerine in the oil is replaced by methanol. Since this amounts to using a fuel (methanol; CH3OH) to produce a f…
Biodiversity is more complex than rare species (giant pandas), areas of high spe
Biodiversity is more complex than rare species (giant pandas), areas of high species diversity (rainforests), big dynamic creatures (whales), or economically important species (co…
Biodiversity plays an important role in the way ecosystems function and in the m
Biodiversity plays an important role in the way ecosystems function and in the many services they provide. Using two credible sources, research the importance of biodiversity's co…
Bioelectrical impedance analysis is a commercially available method used to esti
Bioelectrical impedance analysis is a commercially available method used to estimate body fat percentage. The device applies a small potential between two parts of the patient's b…
Bioenergetics Graph the free energy of the following reactions. (for an example
Bioenergetics Graph the free energy of the following reactions. (for an example of a graph like this please see our slides from the enzyme lecture. 4 pts 8. free energy a. Using a…
Bioengineering Application - Certain vegetables and fruits contain plant pigment
Bioengineering Application - Certain vegetables and fruits contain plant pigments called carotenoids that are metabolized in the body to produce Vitamin A. Lack of Vitamin A cause…
Bioengineering Application The heart pumps blood at an average rate of 5 L/min.
Bioengineering Application The heart pumps blood at an average rate of 5 L/min. The gauge pressure on the venous (intake) side is 0 mm Hg and that on the arterial (discharge) side…
Bioengineering Fundamentals via Ann Saterbak book 11 (M) A burn patient comes in
Bioengineering Fundamentals via Ann Saterbak book 11 (M) A burn patient comes into a hospital emergency room. She is immediately connected to an IV bag to replace the fluids she h…
Bioengineering Fundamentals-Saterbak Problem 4.3 of Textbook A weight is added t
Bioengineering Fundamentals-Saterbak Problem 4.3 of Textbook A weight is added to a piston so that the volume of the gas inside the container is reduced from 2.5 L to 1.0 L at a c…
Bioengineering Fundamentals-Saterbak Problem 4.5 of Textbook A bomb calorimeter
Bioengineering Fundamentals-Saterbak Problem 4.5 of Textbook A bomb calorimeter is a device commonly used to measure the internal energy of a substance, especially in combustion r…
Bioengineering. Please answer each problem fully with details. MNE 525 Homework
Bioengineering. Please answer each problem fully with details. MNE 525 Homework 1) Suppose that Ax is the change in a colligative property of a solution -Le a property that depend…
Bioengineers construct peptides with new functions by starting with a particular
Bioengineers construct peptides with new functions by starting with a particular peptide, and then mutating the amino acid present at different positions. They then screen the res…
Bioengineers construct peptides with new functions by starting with a particular
Bioengineers construct peptides with new functions by starting with a particular peptide and then mutating the amino acid present at different positions. They then screen the resu…
Bioethics Federal Baby Doe Rules initiated in President Reagan\'s administration
Bioethics Federal Baby Doe Rules initiated in President Reagan's administration Applied Roe vs. Wade to babies for the first time Applied the Americans with Disabilities Act to fe…
Biof 3124 Apni5, 2018 Instructor E. Glona C. Regisford, Ph D tam 3 Name 6. (10 p
Biof 3124 Apni5, 2018 Instructor E. Glona C. Regisford, Ph D tam 3 Name 6. (10 points) We have discussed how the lac operon (sce Figure E3-2) is controlled by both the CAP activat…
Biofilms, which are colonies of bacteria that can adhere to living or inert surf
Biofilms, which are colonies of bacteria that can adhere to living or inert surfaces, can cause a wide range of human infections. Infections caused by bacteria living inside the b…
Biogenetics Corporation has a target capital structure of 55 percent equity. The
Biogenetics Corporation has a target capital structure of 55 percent equity. The firm just paid dividends of $1.5 per share and dividends are expected to growth at 10 percent a ye…
Biogeochemical Cycles Chapter 3 of your textbook describes five biogeochemical c
Biogeochemical Cycles Chapter 3 of your textbook describes five biogeochemical cycles (also called nutrient cycles) which carry elements and compounds essential to life on earth: …
Biogeographical evidence Complete the following paragraph to describe the biogeo
Biogeographical evidence Complete the following paragraph to describe the biogeographical evidence supporting descent from a common ancestor. marasupials, amphibians, common, rept…
Biogeography is the study of the distribution of organisms. biogeographical dist
Biogeography is the study of the distribution of organisms. biogeographical distributions. Try to remember what Europeans knew of the World in which we live in the 1200s-1800s In …
Bioinformatics #4 1. What does the box labeled “INSR” refer to, and how many ami
Bioinformatics #4 1. What does the box labeled “INSR” refer to, and how many amino acids are found in this protein? Insulin; 1382 Insulin receptor; 1382 Insulin; 4149 Insulin rece…
Bioinformatics #5 1. According to the KEGG pathway for oxidative phosphorylation
Bioinformatics #5 1. According to the KEGG pathway for oxidative phosphorylation, which of the following enzymes do not shuttle protons into the innermembrane space (IMS)? 1.3.5.1…
Bioinformatics (Microbiology) Here are the websites given for the following ques
Bioinformatics (Microbiology) Here are the websites given for the following questions: Plasmids 101, Origin of Replication http://blog.addgene.org/plasmid-101-origin-of-replicatio…
Bioinformatics Databases The following transcript was found to be abundant in a
Bioinformatics Databases The following transcript was found to be abundant in a human patient’s blood sample. ATGGTGCATCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAA…
Bioinformatics Instructions 1. Choose a protein from your textbook. Write the na
Bioinformatics Instructions 1.       Choose a protein from your textbook. Write the name of the protein, the book chapter, AND the page number and turn in a hard copy to me by TUE…
Bioinformatics is the application of computer science techniques to problems in
Bioinformatics is the application of computer science techniques to problems in biology. Many bioinformatics applications deal with the processing of DNA. DNA, which contains the …
Bioinformatics sequencing excercise. Sequencing the human genome started with ho
Bioinformatics sequencing excercise. Sequencing the human genome started with how many base pairs? Where are all of those base pairs located? Sequencing that many base pairs was a…
Biol 2110 R. Socci 22. A refle x reaction to loud sounds prevents damage to the
Biol 2110 R. Socci 22. A refle x reaction to loud sounds prevents damage to the inner ear. This reaction is due to contraction of: a. Hair cells. b. Tensor tympani & stapedius…
Biol 2110 R. Socci Eer Quctions 28.31- Matching Columa: Match the effect in cola
Biol 2110 R. Socci Eer Quctions 28.31- Matching Columa: Match the effect in colams 1 with is autonomié sublivision in column On GREEN Scantron/ 28. Slows heart rate 29. Stimulates…
Biol 2110 R. Socci Name Date: Questions 1-16:Multiple Choice: Enter the letter o
Biol 2110 R. Socci Name Date: Questions 1-16:Multiple Choice: Enter the letter of the correct answer A resting nerve fiber is polarized because the concentration a. Na+ and K+ ion…
Biol 2110 R. Socci Name: Date: Take-Home Assignment #2-Bones Questions 1-13: Mul
Biol 2110 R. Socci Name: Date: Take-Home Assignment #2-Bones Questions 1-13: Multiple Choice:Enter the letter of the correct answer A ball-and-socket joint of the lower extremity …
Biol 2110 R. Socci What part of the brain receives information about planned act
Biol 2110 R. Socci What part of the brain receives information about planned activity, compares this with actual movements, and supplies corrective feedback signals to other parts…