Bioinformatics Databases The following transcript was found to be abundant in a

Question

Bioinformatics Databases

The following transcript was found to be abundant in a human patient’s blood sample.

ATGGTGCATCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTT

The only information you are given is the above sequence so you must begin your investigation with a sequence search - for this example we will use NCBI’s BLAST service at: http://blast.ncbi.nlm.nih.gov/

Note that there are several different “basic BLAST” programs available at NCBI (including nucleotide BLAST, protein BLAST, and BLASTx).

Q1: Which BLAST program should we use in this case? [HINT, what type of sequence are you provided with]

Q2: What are the names and accession numbers of the top four hits from your BLAST search?

Q3: What are the percent identities for the top few hits?

Q4: How many identical and non-identical nucleotides are there in your top hit compared to your last reported hit?

From the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the “Alignments” section).

Q5: What is the “Official Symbol” and “Official Full Name” for this gene?

Q6: What chromosome is this gene located on?

Q7: What are the names of neighboring genes on this chromosome?

Q8: How many exons and introns are annotated for this gene?

Q9: What is the function of the encoded protein?

Q10: Does the protein have a role in human disease(s)? If so what diseases?

Explanation / Answer

(1)A nucleotide blast will be used.

(2)Name:-Homosapiens hemoglobin subunit beta (HBB)mRNA

Accession number:-NM_000518.5

Name:-Pan troglodytes hemoglobin subunit Beta(HBB)mRNA

Accession number:-XM_508242.4

Name:-Pan paniscus hemoglobin subunit beta(LOC 100976464)

Accession number:-XM_003819029.2

Name:-Homo sapiens hemoglobin beta chain variant Hb S-wake(HBB)mRNA,complete cds

Accession number:-AY136510.1

(3)percentage identity:-99% for top four hits.

(4)628 nucleotides are identical and rest are non identical.

(5)Official symbol:-HBB

Full name:-hemoglobin subunit beta

(6)chromosome11- NC_000011.10

Related Questions

Navigate

• Browse (All)
• Browse B
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.