Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse P

Alphabetical listing with fast deep pagination.
81033 items • Page 115 / 1621

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
PLEASE WRITHE CLEAR AND THE CORRECT ANSWER 1- Find the slope and? y-intercept of
PLEASE WRITHE CLEAR AND THE CORRECT ANSWER 1- Find the slope and? y-intercept of the line. Then use these to write the equation of the line. a-The? y-intercept of the line is at -…
PLEASE YOUR OWN WORK............. INSTRUCTOR APPLY PLAGIARISM CHECKER 6. Greates
PLEASE YOUR OWN WORK............. INSTRUCTOR APPLY PLAGIARISM CHECKER 6. Greatest Common Divisor (GCD) The greatest common divisor (GCD) of two integers is the largest integer tha…
PLEASE answer ALL 7 parts to this questions , I\'d post one at a time, but you n
PLEASE answer ALL 7 parts to this questions, I'd post one at a time, but you need the previous questions to complete the rest of them. Thanks in advance! loblolly.txt data: 4.8909…
PLEASE answer ALL THE QUESTIONS. DO NOT ANSWER IF YOU CANT ANSWER ALL OF IT. 3\'
PLEASE answer ALL THE QUESTIONS. DO NOT ANSWER IF YOU CANT ANSWER ALL OF IT. 3'- GGCCTTAAGCATGCATGCAT -5' 5'- CCGGAATTC(G)TACGTACGTA -3' 1. If a replication fork is moving from ri…
PLEASE answer ALL parts of questions 1 through 5! thank you so much!! 1. A) Name
PLEASE answer ALL parts of questions 1 through 5! thank you so much!! 1. A) Name and briefly describe the three main levels of defenses (show as 1),2),3..). the body presents to i…
PLEASE answer ALL parts of questions 2,3,4, & 5 THANK YOU SO MUCH!!! 2. A) Expli
PLEASE answer ALL parts of questions 2,3,4, & 5 THANK YOU SO MUCH!!! 2. A) Explicitly describe the main steps of the fluid response of acute inflammation. (Describe the sequen…
PLEASE answer ALL parts of questions 6,7,8 & 9 THANK YOU SOOO MUCH!! (This is fo
PLEASE answer ALL parts of questions 6,7,8 & 9 THANK YOU SOOO MUCH!! (This is for my pathophysiology course) 6. A) Differentiate between hyperplasia and hypertrophy by describ…
PLEASE answer all Parts of the questions: Estimate the spring constant for a tra
PLEASE answer all Parts of the questions: Estimate the spring constant for a trampoline. Assume a person is standing on the trampoline and oscillating up and down without leaving …
PLEASE answer all my quesiotns OR don\'t answer at All! You don\'t have to answe
PLEASE answer all my quesiotns OR don't answer at All! You don't have to answer a single quesition if you cant answer all. Dont' waste my time. Please answer all or dont' answer a…
PLEASE answer all, I dont have any more questions left (PLEASE) One connective t
PLEASE answer all, I dont have any more questions left (PLEASE) One connective tissue category is dense connective tissue. Tissues in this category include dense irregular connect…
PLEASE answer in as much DETAILS as possible. Nikola Tesla, one of the inventors
PLEASE answer in as much DETAILS as possible. Nikola Tesla, one of the inventors of radio and an archetypal mad scientist, told a credulous reporter in 1912 the following story ab…
PLEASE answer it in the form it is asked above!!!! F = ( __ i + __ j + __ k ) N
PLEASE answer it in the form it is asked above!!!! F = ( __ i + __ j + __ k ) N 3. -/20 pointsWalker4 22.P.044 Each of the 10 turns of wire in a vertical, rectangular loop carries…
PLEASE answer number 2 (worksheet) I am really struggling with it. Below is the
PLEASE answer number 2 (worksheet) I am really struggling with it. Below is the unadjusted trial balance for Walton Anvils as of December 31, 2016, and the data for the adjustment…
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i can follow and understand) AND SEPERATE BY FILE, AND TITLE THE FILES. * will happily give a thumbs …
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i can follow and understand) AND SEPERATE BY FILE, AND TITLE THE FILES. please only post a complete a…
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i can follow and understand) AND SEPERATE BY FILE, AND TITLE THE FILES. please only post a complete a…
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i can follow and understand) AND SEPERATE BY FILE, AND TITLE THE FILES. please only post a complete a…
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i can follow and understand) AND SEPERATE BY FILE, AND TITLE THE FILES. please only post a complete a…
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i
PLEASE answer the assignment in c++ PLEASE ADD COMMENTS FOR THE CODE( so that i can follow and understand) AND SEPERATE BY FILE, AND TITLE THE FILES. please only post a complete a…
PLEASE answer the boxes in white. & Show all work to ensure accuracy. Please ans
PLEASE answer the boxes in white. & Show all work to ensure accuracy. Please answer the question as asked. The answers in GREEN are correct. Thank you Problem 14-3 Martinez In…
PLEASE answer the entire question. With both the financing and operating perspec
PLEASE answer the entire question. With both the financing and operating perspective. (the last 2 people did not!! it is only one question!!!!! answer all parts) Financial Stateme…
PLEASE answer the following questions 1. As of April 1, Holy Grounds Coffee Corp
PLEASE answer the following questions 1. As of April 1, Holy Grounds Coffee Corp. had total stockholders' equity of $102,000. During April, it wrote checks for $16,000 in salaries…
PLEASE answer the question correctly and neatly so I\'m able to see how you arri
PLEASE answer the question correctly and neatly so I'm able to see how you arrived at your answer. If you do not know how to round or answer the question correctly PLEASE do not a…
PLEASE answer them all I really need help! for Biochemistry The acetylcholine re
PLEASE answer them all I really need help! for Biochemistry The acetylcholine receptor is an example of a -gated channel. voltage signal ligand all of the above none of the above …
PLEASE answer them all I really need help! for Biochemistry The transport of an
PLEASE answer them all I really need help! for Biochemistry The transport of an ion across a membrane against its concentration gradient can be accomplished by: the co-transport o…
PLEASE answer this question using the following table i have created below thank
PLEASE answer this question using the following table i have created below thank you 2. Write a stored procedure named sp_InsertRoomType that can be used to insert a row of data i…
PLEASE answer this question using the following table i have created below thank
PLEASE answer this question using the following table i have created below thank you 3. Write a stored procedure named sp_UpdateRackRates that can be used to update prices on the …
PLEASE answer this question using the following table i have created below thank
PLEASE answer this question using the following table i have created below thank you 4. Write a stored procedure named sp_UpdateFolio that can be used to update the Folio table wi…
PLEASE answer to all questions clearly~!! Ql. Assume the following term structur
PLEASE answer to all questions clearly~!! Ql. Assume the following term structure of interest rates: The YTM on 1-year T-bills = 2%, The YTM on 3-year T-bonds = 5%, The YTM on 5-y…
PLEASE be specific enough in your procedure so I can follow it clearly! And plea
PLEASE be specific enough in your procedure so I can follow it clearly! And please don't make this very expensive. Most I could spend is $20. Thank you so much. Hello, I'm a high …
PLEASE be specific on where the numbers should be! Required Information The foll
PLEASE be specific on where the numbers should be! Required Information The following information applies to the questions displayed below. into the following purchases for March.…
PLEASE be sure everything is included in your answers. 1. Subsidies provided by
PLEASE be sure everything is included in your answers. 1. Subsidies provided by industries involved in unsustainable business practices are most likely to? (a). Damage GDP (b). Le…
PLEASE be sure everything shows in your answer to this question. 1. One of the p
PLEASE be sure everything shows in your answer to this question. 1. One of the problems with habitat fragmentations is that _____ is lost. (a). all animal species are lost (b). ed…
PLEASE be sure to round to the correct decimal point You\'ve observed the follow
PLEASE be sure to round to the correct decimal point You've observed the following returns on Doyscher Corporation's stock over the past five years: -27.0 percent, 15.0 percent, 3…
PLEASE be sure to show everything in your answer to this question. Match each te
PLEASE be sure to show everything in your answer to this question. Match each term with its correct meaning. Terms Sedimentation Western Black Rhino Permian Extinction Steep Slope…
PLEASE can do this in NETBEAN I need that way thank very much Mancala is a famil
PLEASE can do this in NETBEAN I need that way thank very much Mancala is a family of board games played around the world, sometimes called "sowing" games, or "count-and-capture" g…
PLEASE can someone help me. I am so lost with my homework Review of last lab: 1.
PLEASE can someone help me. I am so lost with my homework Review of last lab: 1. Convert, express in scientific notation, and solve: 0. 3131 10, 200 mm 2 Convert: 2 x 104 ml- 1 23…
PLEASE check if this code it right /* Solution of Linear Equations - LU Decompos
PLEASE check if this code it right /* Solution of Linear Equations - LU Decomposition Method */ #include <stdio.h> #include <math.h> #define M 10 /* maximum row */ #de…
PLEASE code using JAVA (UML included!!!) Project: Displaying Regular Polygons Pr
PLEASE code using JAVA (UML included!!!) Project: Displaying Regular Polygons Problem Description: Create a subclass of JPanel, named RegularPolygonPanel, to paint an n-sided regu…
PLEASE complete all the questions that you know. If you see a question with mult
PLEASE complete all the questions that you know. If you see a question with multiple check boxes, that means that all the correct ones need to be selected! If you're not certain a…
PLEASE correct the boxes in RED. the Boxes in GREEN are correct. Please show all
PLEASE correct the boxes in RED. the Boxes in GREEN are correct. Please show all work to ensure accuracy, and answer the question as is. Thank you On September 30, 2012, Lena Co. …
PLEASE describe solution clearly in words. Thanks! Consider a series RLC circuit
PLEASE describe solution clearly in words. Thanks! Consider a series RLC circuit with R = 100 Ohm, L = 75 mH and C = 1.0 muF. Suppose it is driven by an AC voltage source with V0 …
PLEASE don\'t just guess.. it\'s dishonest. Two identical carts roll down hills
PLEASE don't just guess.. it's dishonest. Two identical carts roll down hills and stick together in two different situations 1.Which one of the following statements is truejust be…
PLEASE eXPLAIN WHY YOU CHOSE THAT ANSWER. 1. Which of the following determines t
PLEASE eXPLAIN WHY YOU CHOSE THAT ANSWER. 1. Which of the following determines the quantity demanded of a commodity? a. the # of buyers b. the income levels of consumers c. the pr…
PLEASE explain steps, having troble solving these two questions 1. a) What are t
PLEASE explain steps, having troble solving these two questions 1. a) What are the partial and total pressures of a solution obtained by mixing 35.8 g benzene, C6H6, and 56.7 g to…
PLEASE explain the reasoning behind parts B and C. What are the expected equilib
PLEASE explain the reasoning behind parts B and C. What are the expected equilibrium population sizes for each species? Question 3. You are studying interspecific interactions bet…
PLEASE explain this solution process to me. I am not 100% sure how its done. THA
PLEASE explain this solution process to me. I am not 100% sure how its done. THANKYOU :) Considering the following frequency responses for causal and stable discrete-time LTI syst…
PLEASE explain this solution process to me. I am not 100% sure how its done. THA
PLEASE explain this solution process to me. I am not 100% sure how its done. THANKYOU :) Considering the following frequency responses for causal and stable discrete-time LTI syst…
PLEASE explain what is the difference between these two theorems of induction. L
PLEASE explain what is the difference between these two theorems of induction. Let P1, P2. . . be a sequence of propositions. Suppose that P1 is true. For each n N, if Pn is true,…
PLEASE explain why the answer is A and not the other options 3 pts. 4. For each
PLEASE explain why the answer is A and not the other options 3 pts. 4. For each of the same two muscles described in the previous question, a single motor axon was isolated and st…