Browse D
Alphabetical listing with fast deep pagination.
30085 items • Page 221 / 602
Design a decorative \"mobile\" to consist of a low-mass rod of length 0.46 m sus
Design a decorative "mobile" to consist of a low-mass rod of length 0.46 m suspended from a string so that the rod is horizontal, with two balls hanging from the ends of the rod. …
Design a derived class circleType. Every circle has a center and a radius. Given
Design a derived class circleType. Every circle has a center and a radius. Given the radius, we can determine the circle’s area and circumference. Given the center, we can determi…
Design a design pattern for a two-factor authentication component for web-based
Design a design pattern for a two-factor authentication component for web-based systems. Define the design pattern using the elements below of the design pattern description as de…
Design a detailed business plan for a new product, service, or business venture
Design a detailed business plan for a new product, service, or business venture of your choice. This could be an idea you have been contemplating or a product presently being mark…
Design a detailed post-implementation evaluation form. The form should consist o
Design a detailed post-implementation evaluation form. The form should consist of questions that you could use to evaluate the information system of Victorian Creations Company de…
Design a difference amplifier with a single op-amp with: Ad = 10 V/V Acm = 0 Rid
Design a difference amplifier with a single op-amp with: Ad = 10 V/V Acm = 0 …
Design a digital clock display using Common Cathode 7-segment display modules an
Design a digital clock display using Common Cathode 7-segment display modules and a mode switch. The clock, normally displays the time in hh-mm-ss format. It updates the time auto…
Design a digital clock display using Common Cathode 7-segment display modules an
Design a digital clock display using Common Cathode 7-segment display modules and a mode switch. The clock, normally displays the time in hh-mm-ss format. It updates the time auto…
Design a digital system with three 16-bit registers AR, BR, and CR and 16-bit da
Design a digital system with three 16-bit registers AR, BR, and CR and 16-bit data input IN to perform the following operations, assuming a two's complement representation and ign…
Design a digital system with three 16-bit registers AR, BR, and CR and 16-bit da
Design a digital system with three 16-bit registers AR, BR, and CR and 16-bit data input IN to perform the following operations, assuming a two's complement representation and ign…
Design a disaster recovery plan that will prepare the institution and employees
Design a disaster recovery plan that will prepare the institution and employees prior to the disaster incident in order to secure data and prevent injury to patients. Include at a…
Design a discrete signal processing system on MATLAB to estimate the respiratory
Design a discrete signal processing system on MATLAB to estimate the respiratory signals from finger Photoplethysmography (PPG) signals for three fixed metronomic frequencies (15,…
Design a displacement profile for the follower fo a single-dewll cam. the perfor
Design a displacement profile for the follower fo a single-dewll cam. the performance speciications are as follows: Machine cycle is 2 seconds, Rise from 0"to 2: in 60 degrees, fa…
Design a distributed system that is composed of one client and 5 servers: 1- The
Design a distributed system that is composed of one client and 5 servers: 1- The client application generates an array of size 10000 random double values and has 5 threads each of…
Design a divide-and-conquer algorithm for computing the number of levels in a CO
Design a divide-and-conquer algorithm for computing the number of levels in a COMPLETE binary tree. In particular, the algorithm should return 0 and 1 for the empty and single-nod…
Design a divide-and-conquer algorithm for computing the number of levels in a bi
Design a divide-and-conquer algorithm for computing the number of levels in a binary tree. In particular, the algorithm should return 0 and 1 for the empty and single-node trees r…
Design a double dwell cam to move a follower from 0 to 50 mm in 75 degree in a C
Design a double dwell cam to move a follower from 0 to 50 mm in 75 degree in a Cycloidal motion, dwell for 75 degree, fall 50 mm in 75 degree in a constant acceleration motion, an…
Design a driver/decoder for a six-segment display described below (where e is th
Design a driver/decoder for a six-segment display described below (where e is the vertical line and f is the horizontal line). It is to display one of the twelve symbols shown, wh…
Design a file copying program named FileCopy using ordinary pipes. This program
Design a file copying program named FileCopy using ordinary pipes. This program will be passed two parameters: the first is the name of the file to be copied and the second is the…
Design a finite state machine (FSM) that cycles through the last 4 digits of you
Design a finite state machine (FSM) that cycles through the last 4 digits of your student ID in a loop. In your design there should be an input that changes the direction of the c…
Design a finite state machine (FSM) that cycles through the last 4 digits of you
Design a finite state machine (FSM) that cycles through the last 4 digits of your UTEP student ID in a loop. In your design there should be an input that changes the direction of …
Design a finite state machine (FSM) that cycles through the last 4 digits of you
Design a finite state machine (FSM) that cycles through the last 4 digits of your student ID in a loop. In your design there should be an input that changes the direction of the c…
Design a finite state machine and implement this FSM as a controller. The FSM wi
Design a finite state machine and implement this FSM as a controller. The FSM will capture the behavior of the calculator. The calculator is a relatively simple 8-bit calculator .…
Design a fire water service for the apartment building at the top of the hill. R
Design a fire water service for the apartment building at the top of the hill. Required fire flow for the building's sprinkler system is 500 gpm at 20 psi residual pressure. Accor…
Design a first-order, low-pass filter (RC circuit shown) to meet the performance
Design a first-order, low-pass filter (RC circuit shown) to meet the performance specifications for the situation described below. An input signal comes from a temperature sensor …
Design a flexible (1,000,000 ESAL) and a rigid (3,000,000 ESAL) pavement. Based
Design a flexible (1,000,000 ESAL) and a rigid (3,000,000 ESAL) pavement. Based on the highway classification, assume a reliability and use standard deviation of So=0.4 a. Design …
Design a flow chart based on this C++ code #include #include #d
Design a flow chart based on this C++ code #include<stdio.h> #include<math.h> #define PI 3.14159265 const int k = 20; struct DFT_Coefficient { double real, img; }; …
Design a fluidized bed gasifier. The product gas consist of H 12 m\'/min, CH4- 4
Design a fluidized bed gasifier. The product gas consist of H 12 m'/min, CH4- 4 m/min co 15 m min CO2 (stoichiometric basis) and unreacted Air (stoichiometric basis). The gasifier…
Design a fluidized bed gasifier. The product gas consist of H 12 m\'/min, CH4- 4
Design a fluidized bed gasifier. The product gas consist of H 12 m'/min, CH4- 4 m/min co 15 m min CO2 (stoichiometric basis) and unreacted Air (stoichiometric basis). The gasifier…
Design a forward and reverse primer ATGTCTAAAACTGGAGGCAAGATTAGTTTCTACGAA GACCGAA
Design a forward and reverse primer ATGTCTAAAACTGGAGGCAAGATTAGTTTCTACGAA GACCGAAATTTTCAAGGCCGCCGCTATGACTGCGACTGCGACTGCGCAGACTTCCGCTCGTACCTAAGTCGCTGCAACTC CATTAGAGTAGAGGGAGGCACCTGG…
Design a four-bit function unit that has two four-bit operand inputs, A and B Th
Design a four-bit function unit that has two four-bit operand inputs, A and B There is an additional single-bit data input Cn that is the carry bit from a previous operation so mu…
Design a fraction class. The class should have 2 data members to represent the n
Design a fraction class. The class should have 2 data members to represent the numerator and denominator. Both of these numbers should obviously be integers. It should be able to …
Design a function StatisticS() Generate 100 random numbers in the range of [-100
Design a function StatisticS() Generate 100 random numbers in the range of [-100, 100 ] ; Sum all the negative numbers and store the result in sumN Count all the negative numbers …
Design a function named findMax that accepts two integer values as arguments and
Design a function named findMax that accepts two integer values as arguments and returns the value that is the greater of the two. For example, if 7 and 12 are passed as arguments…
Design a function pretty-print that consumes a string and an integer and that pr
Design a function pretty-print that consumes a string and an integer and that produces an image of the text that results from appending the integer to the end of the string. The r…
Design a function sperate() in your class with no arguments that returns a stand
Design a function sperate() in your class with no arguments that returns a standard array of four rectangles. Calculate the position and size of the four rectangles to correspond …
Design a function that counts the number of times the item x appears among the f
Design a function that counts the number of times the item x appears among the first n elements of the array a and returns that count as the frequency of x in a. c++ 1 #include Ki…
Design a function that will display which operations were executed (option K in
Design a function that will display which operations were executed (option K in the menu). For this "extra" part you should indicate where your process does this and provide the "…
Design a game of Yahtzee using C++ using a header.h file, main.c file, and a equ
Design a game of Yahtzee using C++ using a header.h file, main.c file, and a equations.c file. You may design the Yahtzee game with functions that you see fit. I recommend that yo…
Design a general class GeometricObject can be used to model all geometric object
Design a general class GeometricObject can be used to model all geometric objects. This class contains the properties color and plied and their appropriate get and set methods. As…
Design a generic class or structure to store the following information about a c
Design a generic class or structure to store the following information about a customer account: Name Address City , State , and Zip Telephone Number Account balance Date of last …
Design a generic class tohold the following information about a bank account: Ba
Design a generic class tohold the following information about a bank account: Balance,Number of deposits this month, Number of withdrawals, Annualinterest rate, Monthly service ch…
Design a geothermal operation to provide electricity for a remote island, at lev
Design a geothermal operation to provide electricity for a remote island, at level of 100 MW power. The island is located at a location that magma close to the earth surface is at…
Design a go-anywhere, use-anywhere wind screen for outdoor recreational and casu
Design a go-anywhere, use-anywhere wind screen for outdoor recreational and casual-living activities, including sunbathing, reading, cooking, and picnicking. The wind screen must …
Design a grade average program that will produce the numerical grade average of
Design a grade average program that will produce the numerical grade average of test scores input by a user. Your program design should contain the following: you must use an Arra…
Design a grade average program that will produce the numerical grade average of
Design a grade average program that will produce the numerical grade average of test scores input by a user. Your program should contain the following: • You must use an Array as …
Design a grade average program that will produce the numerical grade average of
Design a grade average program that will produce the numerical grade average of test scores input by a user. Your program design should contain the following: You must use an Arra…
Design a grade average program that will produce the numerical grade average of
Design a grade average program that will produce the numerical grade average of test scores input by a user. Your program design should contain the following: You must use an Arra…
Design a graph class that stores a directed, unweighted graph using an adjacency
Design a graph class that stores a directed, unweighted graph using an adjacency matrix. Vertices will be contiguous integers starting at 0, and the number of vertices will be ava…
Design a graphic that would show a car parking into a parking slot in a parking
Design a graphic that would show a car parking into a parking slot in a parking lot of at least 14 parking slots. Please park your car after driving past half way of the drive way…