Browse 0-9

1. A gaseous hydrocarbon collected over water at a temperature of 21 degree C an

1. A gaseous hydrocarbon collected over water at a temperature of 21 degree C and barometric pressure of 753 torr occupied a volume of 48.1 mL. the hydrocarbon in this volume weig…

1. A gene X contains the following piece of sequence close to the transcription

1. A gene X contains the following piece of sequence close to the transcription starting site 5' - CCTCCAAAGAAGAAAAGGAAGGTC 3 A. (5 pts) Write the mRNA sequence, translate into am…

1. A general calculation method for transfer prices that achieves goal congruenc

1. A general calculation method for transfer prices that achieves goal congruence begins with the additional outlay cost per unit incurred because goods are transformed and then a…

1. A general condition that two waves undergo constructiveinterference is that:

1. A general condition that two waves undergo constructiveinterference is that: a. their phase difference iszero. b. their phase differenceis /2 rad. c. theirphase difference is ±…

1. A generalization of the Caesar cipher, known as the Affine cipher, has the fo

1. A generalization of the Caesar cipher, known as the Affine cipher, has the following form: Assume that the alphabet is {a, b, …, z} and that a = 0, b = 1, …, z = 25. The key is…

1. A generator coil is rotated through one-fourth of a revolution (from = 0º to

1. A generator coil is rotated through one-fourth of a revolution (from = 0º to = 90º) in 11 ms. The 237-turn circular coil has a 4.7 cm radius and is in a uniform 1.96 T magnetic…

1. A generator is designed to produce a maximum emf of 180 V while rotating with

1. A generator is designed to produce a maximum emf of 180 V while rotating with an angular speed of 3600 rpm. Each coil of the generator has an area of 0.057 m2. If the magnetic …

1. A generic computer has a cache with a 50nsec access time and main memory with

1. A generic computer has a cache with a 50nsec access time and main memory with 200nsec access time. The CPU makes 5000 memory accesses, of these 450 were cache misses. a. Calcul…

1. A generous university benefactor has agreed to donate a large amount of money

1. A generous university benefactor has agreed to donate a large amount of money for student scholarships. The money can be provided in one lump-sum of $10mln, or in parts, where …

1. A generous university benefactor has agreed to donate a large amount of money

1. A generous university benefactor has agreed to donate a large amount of money for student scholarships. The money can be provided in one lump-sum of $10mln, or in parts, where …

1. A geneticist performs a tetrahybrid cross (crossing two plants that vary at 4

1. A geneticist performs a tetrahybrid cross (crossing two plants that vary at 4 traits) and wants to predict the probability of obtaining specific types of offspring. He works fo…

1. A geneticist performs a tetrahybrid cross (crossing two plants that vary at 4

1. A geneticist performs a tetrahybrid cross (crossing two plants that vary at 4 traits) and wants to predict the probability of obtaining specific types of offspring. He works fo…

1. A giant rolls a bowling ball with a uniform speed of 30 m/s (about 70 mph) ac

1. A giant rolls a bowling ball with a uniform speed of 30 m/s (about 70 mph) across the top of his large desk. The ball rolls off the edge of the desk and lands on the floor 120 …

1. A giant rolls a bowling ball with a uniform speed of 30 m/s (about 70 mph) ac

1. A giant rolls a bowling ball with a uniform speed of 30 m/s (about 70 mph) across the top of his large desk. The ball rolls off the edge of the desk and lands on the floor 120 …

1. A giant rolls a bowling ball with a uniform speed of 30 m/s (about 70 mph) ac

1. A giant rolls a bowling ball with a uniform speed of 30 m/s (about 70 mph) across the top of his large desk. The ball rolls off the edge of the desk and lands on the floor 120 …

1. A giant rolls a bowling ball with a uniform speed of 30 m/s (about 70 mph) ac

1. A giant rolls a bowling ball with a uniform speed of 30 m/s (about 70 mph) across the top of his large desk. The ball rolls off the edge of the desk and lands on the floor 120 …

1. A giraffe has a large blood vessel running down its leg. This blood vessel de

1.     A giraffe has a large blood vessel running down its leg.  This blood vessel descends 2.5 m from the heart.  The radius at its upper end is 0.5 cm, and the pressure in the v…

1. A glass object receives a positive charge of +3 nC by rubbing it with a silk

1. A glass object receives a positive charge of +3 nC by rubbing it with a silk cloth. In the rubbing process have protons been added to the object or have electrons been removed …

1. A glass rod is submerged in water. The end of the rod has the shape of a hemi

1. A glass rod is submerged in water. The end of the rod has the shape of a hemisphere of radius 2.2 cm, bulging outward. Point P is in the water along the optical axis at a dista…

1. A glass tube maker claims that their tubes have lengths that are have true me

1. A glass tube maker claims that their tubes have lengths that are have true mean 9.00cm, and true variance 0.25cm2 . (a) What is the probability that a random sample of 40 tubes…

1. A glucose meter shows that a patient’s blood contains 125 mg% of glucose. Exp

1. A glucose meter shows that a patient’s blood contains 125 mg% of glucose. Express this value in mg/ml. 2. What is the creatinine clearance (ml/min) for a 35 year old female who…

1. A golf ball is released from rest from the top of averytall building. Choose

1. A golf ball is released from rest from the top of averytall building. Choose a coordinates system whose origin is at thestarting point of the ball, and whose y axis points vert…

1. A golfer tees off from an elevated tee, H = 3m; the ballrises initially at an

1. A golfer tees off from an elevated tee, H = 3m; the ballrises initially at an angle of elevation = 350and speed V0 = 28 m/s. How far from the tee doesthe ball strike the ground…

1. A good demonstration is defined as: a) Is essential in research presentations

1. A good demonstration is defined as: a) Is essential in research presentations to facilitate understanding of statistics   b) creates a natural, emotional response   c) contains…

1. A good example of popular culture is the following: a) opera b) Classical sym

1. A good example of popular culture is the following: a) opera b) Classical symphony c)Art galleries d) The World Series (baseball championship) 2.A good example of folk culture …

1. A good is currently produced in a perfectly competitive market. The market de

1. A good is currently produced in a perfectly competitive market. The market demand for the good is P = -0.01QD + 15. There are 50 firms in this market each with a MC = 0.8qf + 2…

1. A good with a postive network effect a. likely to be in a surplus more than o

1. A good with a postive network effect a. likely to be in a surplus more than other goods b. will have more elastic demand than it would have without the network effect c. rreqiu…

1. A good without any close substitutes is likely to have relatively _______? de

1. A good without any close substitutes is likely to have relatively _______?  demand, because consumers cannot easily switch to a substitute good if the price of the good rises. …

1. A good\'s Demand Curve is: Q d = 20 - P, and its Supply Curve is: Q s = 5 + 2

1. A good's Demand Curve is: Qd = 20 - P, and its Supply Curve is: Qs = 5 + 2P. a. When P = $10, what is the difference, if any, between Qd and Qs? (5 points) b. When P = $2, is t…

1. A gourmet chef inoculated a delicious potato salad with 6 Staphylococcus aure

1. A gourmet chef inoculated a delicious potato salad with 6 Staphylococcus aureus cells. If S. aureushas a generation time of 60 minutes, how many cells would be in the culture a…

1. A gracious welcome by an employee at the hotel check-in counter is an example

1. A gracious welcome by an employee at the hotel check-in counter is an example of: (A) social sustainability. (B) predictive analytics. (C) service blue print. (D) moment of tru…

1. A grad student has a culture of E. coli with a total volume of 1,800 mL, and

1. A grad student has a culture of E. coli with a total volume of 1,800 mL, and OD reading at 550 nm of 1.7. He transfers 1 mL culture into 9 mL tryptone broth. Next, he transfers…

1. A grad student has a culture of E. coli with a total volume of 1,800 mL, and

1. A grad student has a culture of E. coli with a total volume of 1,800 mL, and CD reading at 550 nm of 1.7. He transfers 1 mL culture into 9 mL tryptone broth. Next, he transfers…

1. A graduate student is studying bromobenzene, and decides to take an El mass s

1. A graduate student is studying bromobenzene, and decides to take an El mass spectrum of it. A research scientist suggests that he take the mass spectra at 50 eV, 70 eV and 120 …

1. A graduate student studying a 350 base pair molecule of DNA found that 20% of

1. A graduate student studying a 350 base pair molecule of DNA found that 20% of these nucleotides were adenine. How many nucleotides were Guanine? Cytosine? Thymine? Uracil? Expl…

1. A graduated cylinder with a least count of ± 0.5 ml is used in a density ooo

1. A graduated cylinder with a least count of ± 0.5 ml is used in a density ooo T-Mobile LTE 2:52 PM bbhosted.cuny.edu 2996 0.5 A graduated cylinder with a least count of experime…

1. A grammar for which two distinct parse trees are possible for the same string

1. A grammar for which two distinct parse trees are possible for the same string is considered to be ambiguous.?? True ?False 2. The lexical structure of a programming language is…

1. A greenhouse experiment was set up in which a series of pots were placed on a

1. A greenhouse experiment was set up in which a series of pots were placed on a tabletop. Each pot contained a similar soil mixture and three bean seedlings of the same size. A t…

1. A greeting card company is starting a new business venture and is in the proc

1. A greeting card company is starting a new business venture and is in the process of evaluating its product lines. Information for one new product, traditional parchment grade c…

1. A grindstone of radius 4.0 m is initially spinning with anangular speed of 8.

1. A grindstone of radius 4.0 m is initially spinning with anangular speed of 8.0 rad/s. The angular speed is then increased to12 rad/s over the next 4.0 seconds. Assume that the …

1. A grindstone spinning at a rate of 20 rev/s has what approximate angular spee

1. A grindstone spinning at a rate of 20 rev/s has what approximate angular speed? 2 A 0.50 kg mass is whirled around at the end of a 1.00 m string. The mass sweeps out a horizont…

1. A group of 500 students have an average age of 18.4 years with a standard dev

1. A group of 500 students have an average age of 18.4 years with a standard deviation of 0.9. The ages are normally distributed. Find the probability that a person is selected at…

1. A group of 6 volleyball players, Ally, Brad, Claire, Devon, Ewing, and Frank

1. A group of 6 volleyball players, Ally, Brad, Claire, Devon, Ewing, and Frank are going to play doubles (two on each team). Suppose that they decide to draw four names out of a …

1. A group of 6 volleyball players, Ally, Brad, Claire, Devon, Ewing, and Frank

1. A group of 6 volleyball players, Ally, Brad, Claire, Devon, Ewing, and Frank are going to play doubles (two on each team). Suppose that they decide to draw four names out of a …

1. A group of DNA nucleotides that codes for a single amino acid is a: · promote

1. A group of DNA nucleotides that codes for a single amino acid is a: ·       promoter ·       gene ·       codon 2. Unlike what Mendel observed in his pea plants, which were eit…

1. A group of Sacramento Valley rice farms are owner-members of Farmer Rice Coop

1. A group of Sacramento Valley rice farms are owner-members of Farmer Rice Cooperative (FRC). They are considering where to market their rice. The local option is through a one m…

1. A group of antennas or antenna elements arranged to provide the desired direc

1. A group of antennas or antenna elements arranged to provide the desired directional characteristics is called: A) a lumped element. B) a vertical antenna. C) a marconi antenna.…

1. A group of antennas or antenna elements arranged to provide the desired direc

1. A group of antennas or antenna elements arranged to provide the desired directional characteristics is called: A) a lumped element. B) a vertical antenna. C) a marconi antenna.…

1. A group of network designers at the communication company SNet have a connect

1. A group of network designers at the communication company SNet have a connected graph G(E,V) in which nodes represent sites that want to communicate. Each edge e is a communica…

1. A group of people were selected and polled about their opinion on imposing ne

1. A group of people were selected and polled about their opinion on imposing new knife control laws. Everyone was asked other questions about themselves as well party. Sex Party …