BIOCHEM I EXAM IV (TAKE HOME) PLEASE BE CONCISE AND TO THE POINT 1. Which positi

Question

BIOCHEM I   EXAM IV (TAKE HOME)

PLEASE BE CONCISE AND TO THE POINT

1. Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

2. Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimensional structure of double-stranded DNA?

3. One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3’). Write the base sequence of the complementary strand.

What special type of sequence is contained in this DNA segment?

Does the double-stranded DNA have the potential to form any alternative structures?

4. Calculate the standard free-energy change for each of the following enzyme-catalyzed reactions, using the equilibrium constants given for the reactions at 25 oC and pH 7.0.

                                                              aspartate

                                                         aminotransferase

(a) Glutamate + oxaloacetate                                     aspartate +  a-ketoglutarate K’eq =  6.8

                                                        triose phosphate

                                                            isomerase

(b) Dihydroxyacetone phosphate                         glyceraldehyde 3-phosphate K’eq = 0.0475

                                                                    phosphofructokinase

(c) Fructose 6-phosphate +  ATP fructose                      1,6-bisphosphate + ADP K’eq = 254

5. Free Energy of Hydrolysis of CTP Compare the structure of the nucleoside triphosphate CTP with the structure of ATP.  Now predict the K’eq and G’o for the following reaction:

                                ATP +   CDP                      ADP +  CTP

6. NADH and NADPH are soluble electron carriers. Cell oxidation of fuels such as, pyruvate and fatty acids occur in the mitochondria matrix whereas the reductive biosynthetic processes such as fatty acid synthesis take place in the cytosol. Based on these observations, in which of the 2 compartments where do you expect to find the highest concentration of each electron carrier? Explain.

7. A “pulse-chase“ experiment using radioactive  14C-labeled carbon sources is carried out on a yeast extract maintained under strictly anaerobic conditions to produce ethanol.

The experiment consists of incubating a small amount of 14C-labeled substrate (the pulse) with the yeast extract just long enough for each intermediate in the fermentation pathway to become labeled. The label is then “chased” through the pathway by the addition of excess unlabeled glucose. The chase effectively prevents any further entry of labeled glucose into the pathway.

(a) If [1-14C]glucose (glucose labeled at C-1 with 14C) is used as a substrate, what is the location of 14C in the product ethanol? Explain.

(b) Where would 14C have to be located in the starting glucose to ensure that all the 14C activity is liberated as 14CO2 during fermentation to ethanol? Explain.

8. Glycolysis Shortcut Suppose you discovered a mutant yeast whose glycolytic pathway was shorter because of the presence of a new enzyme catalyzing the reaction

                                                                NAD+       NADH +  H+

                        Glyceraldehyde 3-P  +  H2O                        3-Phosphoglyerate

Would shortening the glycolytic pathway in this way benefit or harm the cell? Explain.

What will be the effect of this mutation in a cell undergoing aerobic metabolism? Explain.

9. The transformation of glucose to lactate in myocytes releases only about 7% of the free energy released when glucose is completely oxidized to CO2 and H2O. Does this mean that anaerobic glycolysis in muscle is a wasteful use of glucose? Explain

10. Adults engaged in strenuous physical activity require an intake of about  160 g of carbohydrate daily but only about 20 mg of niacin for optimal nutrition. Lack of niacin would prevent a person from this type of activity. Given these observations,

a. How do you explain the role of niacin in metabolism?

b. How do you explain the small amounts of niacin needed compared to the amount of carbohydrates intake?

Explanation / Answer

Positions in the purine ring of a purine nucleotide used to form hydrogen bonds:

Hydrogen bonds are formed in between purines and pyrimidines. Cyclic-aromatic ring of every nucleotide base is used to link to each other by hydrogen bonds. Guanine 6 and 2 rd number carbon attached Nitrogen and oxygen atom and 3rd number Nitrogen atom attach with 2,3 and 4 number in cytosine. Adenine attach by 1 –nitrogen, 6-carbon linked nitrogen atom to 3 and 4 positioned atom of thymine. Hydrogen bonds form between nitrogen and oxygen atoms of nucleotides.

Related Questions

Navigate

• Browse (All)
• Browse B
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.