Determine the amino acid sequence of the peptide that results from translation o
ID: 1059483 • Letter: D
Question
Determine the amino acid sequence of the peptide that results from translation of the following nucleotide sequence in the template strand: GCTGGTGTGTGAGTGGGTGGT.
a. Arg-Pro-Thr-Thr-His-Pro-Pro
b. Ser-Thr-His-Ser-His-Thr-Thr
c. Ala-Gly-Val-STOP
d. Thr-Thr-His-Ser-His-Thr-Ser
Which DNA polymerase is most responsible for chain elongation in E. coli?
a. DNA polymerase IV.
b. DNA polymerase III.
c. Reverse Transciptase
d. DNA polymerase II.
Which statement is not true about G proteins?
a. They are slowly inactivated by their own GTPase activity.
b. They are peripheral membrane proteins
c They are converting ATP to cyclic AMP.
d. They are involved in signal transduction pathways.
Bugs Bunny is Running away from Elmer Fudd. Explain why it is beneficial for Mr. Bunny the enzymes in his muscles reduce pyruvate to lactate.
Which statement is true about the number of initiation and STOP codons?
a. One initiation codon; multiple STOP codons
b. Multiple codons for both initiation and STOP
c. Multiple initiation codons; one STOP codon
d. One initiation codon; one STOP codon
Lactose permease is an example of
a. a proton pump.
b. a lactose channel.
c. secondary active transport.
Which is not a property of RNA polymerase?
a. needs template and primer.
b. polymerizes a reaction assisted by pyrophosphate hydrolysis.
c. has exonuclease proof-reading activity
d .catalyzes the formation of phosphodiester linkages.
True or False? The Glycolysis is a catabolic pathway. why?
Glucose enter liver cells mainly_____________.
a, via Glut-1
b. via Glut-4.
c. by active transport.
d. via Glut-2.
The coding strand of DNA is copied by RNA polymerase from
a. 5' 3' end.
b. 3' 5' end.
c. 3' 5' in prokaryotes, 5' 3' in eukaryotes.
d. from the first nucleotide of the promoter.
The type of RNA that is least stable in cells is ________.
a. mRNA
b. rRNA
c. tRNA
d. Small nuclear RNA.
In strenuously working muscle the pH decreases. This inhibits the activity of PFK-1 and glycolysis slows. Why would it be desirable to slow glycolysis when the demand for ATP is high?
a. Slowing glycolysis slows the rate of decrease in pH. A low pH can be harmful and potentially fatal.
b. The less active form of PFK-1 is a potent allosteric activator of creatine, so even though glycolysis is slowed, ATP production is actually increased by the activation of creatine.
c. Inhibition of PFK-1 allows for the complete oxidation of pyruvate via the citric acid cycle.
d. As PFK-1 is inhibited, its isozyme, PFK-2 is activated. PFK-2 is functional at a much lower pH than PFK-1.
During transcription the RNA polymerase encounter the sequence AGGACCG in the template strand. Deduce the nucleotide sequence in the mRNA transcribed from the sequence. Answer.
The very useful restriction enzyme SpoBob hydrolyses the phosphodiester bond between the guanylates in the sequence AGGACCA. Is SpoBob generating blunt or sticky ends? Please explain.
Compare and contrast the state of the glycolysis in resting and contracting muscle. Answer.
In the mitochondria phosphate ion (PO43-) and H+ are transported together from the intermembrane space into the matrix. Which statement applies?
a The transport protein is a symport.
b. The transport protein is an antiport.
c. This must be a passive transport protein.
d. A and B
PKA is activated when
a. Insulin binds to the insulin receptor.
b. GTP is converted to GDP by the G-protein.
c. When the G-protein dissociates from adenylyl cyclase.
d. glucagon binds to its 7TM-receptor.
a. Arg-Pro-Thr-Thr-His-Pro-Pro
b. Ser-Thr-His-Ser-His-Thr-Thr
c. Ala-Gly-Val-STOP
d. Thr-Thr-His-Ser-His-Thr-Ser
Explanation / Answer
The amino acid sequence of the peptide that results from translation of GCTGGTGTGTGAGTGGGTGGT nucleotide sequence in the template strand in 5'3' direction is A G V Stop V G G, hence, the answer for question 1 is (c) Ala-Gly-Val-STOP
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.