primers for the polymerase chain reaction are designd from the ends of the seque

Question

primers for the polymerase chain reaction are designd from the ends of the sequence of interest. what five base pair primers are necessary to amplify the sequence? By convention primers are written 5 to 3

3. Primers for polyrnerase chain roaction ara desigred fram the ends of the sequence of interest. What 5 basepsir prirers are recessary to ampify this sequence? By corvention prmers are wrinten 5' 1o 3 3'ACCTGGTTCGTTCTAAAGTGASTCGCECGATGATAGGGTCGATTATCTTATCTAT 5 TGGACCAAGCAAGATTICACTCAGCGCGCTACTATCCCAGCTAATAGAATAGATA

Explanation / Answer

Polymerase chain reaction is a technique to ampilfy the sequence of interest. A very small amount of DNA sample is necessary to amplify. In this two DNA strands are required oe is the DNA of interest and the other is the complementary DNA. The base pairs that are required for the amplification are the adenine, guanine, cyosine and thyamine.

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.