Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using fo

ID: 320470 • Letter: Y

Question

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below:

Primer-F:    CGTTTCCCGCCTTCAGTTTAGC

Primer-R: CCCGATCTAGTAACATAGATGACACC

a.) Based on protocol we used in class for DreamTaq DNA polymerase design PCR cycling program for amplification of this fragment.

PCR cycling program:

Put the tubes into the thermocycler programmed as follows:

95°C initial denaturation, 2 min (1 cycle)

35 cycles of:

95°C denaturation, 30 seconds

54°C annealing, 30 seconds

72°C extension, 1 min

Final extension:

72°C extension for 5 min (1 cycle)

4°C cool down

Explanation / Answer

A mixture of Template (Target DNA sequence), primers (single strand oligonucliotide), dNTP’s (dATP, dGTP, dCTP, dTTP), taq DNA polymerase enzyme and buffer solution to keep constant pH. This mixture is introduced in to the thermoclyer. Then we can program it for following sequence of temperature as mentioned in the question to multiply the target DNA sequence.

95°C initial denaturation, 2 min (1 cycle)

35 cycles of:

95°C denaturation, 30 seconds

54°C annealing, 30 seconds

72°C extension, 1 min

Final extension:

72°C extension for 5 min (1 cycle)

4°C cool down

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote