Preview File Edit View Go Tools Window Help 0 1??4) 85%. Fri 9:04 AM a ? s lMG_1

Question

Preview File Edit View Go Tools Window Help 0 1??4) 85%. Fri 9:04 AM a ? s lMG_1066.jpg Edited Q Search 4. The sequence of the oligonucleotides used for the PCR amplification of the Ampicillin resistance gene (Bla) are: a. BlaF (oDMO318): 5'-GAGTATTCAACATTTCCGTGTCG-3 b. BlaR (oDM0319): 5'-CCAATGCTTAATCAGTGAGGCACC-3' The sequence of the ampicillin resistance gene is shown below. Please highlight or underline where BlaF and BlaR are annealing to the DNA for amplification. Based on this knowledge, you should be able to predict the size of the amplified DNA fragment you will observe on the agarose gel that you will run next week. What is the predicted size of the PCR product of the Bla gene? PCR fragment size is 002 bp 6I Page 10 i P ag e g@ ? 0 ???? ?. ? ??

Explanation / Answer

PCR product size is 806 bp

Froward sequence starting from 7 th basepair and reverse primer binding from 839th basepair (3'GGTGCCTCACTGATTAAGCATTGG5'-revese complement of reverse primer)

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.