29. (6 points) The following is a segment of DNA containing a portion of the 5\'

Question

29. (6 points) The following is a segment of DNA containing a portion of the 5'UTR and the beginning of a gene. There are no introns. 3' GGGCATACTTCAGTCAAGAGACATAGATCCGTATG -5' 5 CCCGTATGAAGTCAGTTCTCTGTATCTAGGCATAC -3' If an RNA polymerase were to transcribe the gene from left to right, is the top or the bottom strand serving as the template? What will be the sequence of the mRNA produced? Label the ends of the molecule What is the amino acid sequence of the peptide that would be translated from the mRNA. Label the ends of the molecule. Gly Phe Glu (G) (F) IDI Tyr

Explanation / Answer

The top strand 3' to 5' will serve as the templated strand if the trnascription takes place from left to right.

MRNA sequence -5' CCCGUAUGAAGUCAGUUCUCUGUAUCUAGGCAUAC 3'

amino acid--proline valine

Here the translation will stop after two amino acids since there is a intermediate stop codon UGA

Related Questions

Navigate

• Browse (All)
• Browse 2
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.