DINA molecule is shown below. The start of a gene is indicated as the +1 base 3

Question

DINA molecule is shown below. The start of a gene is indicated as the +1 base 3 'ATATAAAAGATATACGTGTAAACGTTCATT 5' (strand B) (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (0.5 pts.). (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the 5* and 3 ends, and noting any modifications that would be added to a mature mRNA molecule in a EUKARYOTE (0.5 pts.). (C) Label the following on your mRNA above: start codon, stop codon, S'UTR, 3' UTR (0.5 pt) (D) Using the genetic code at the end of this exam, determine the sequence of the polypeptide that would be translated from the mRNA you determined in (B)(0.5 pts.). (E) Note the base pair in the DNA molecule at the beginning of this problem that is labeled with an arrow For the following changes in the DNA at that base pair, indicate the new codon that would be transcribed and then translated, and the name of the type of mutation (0.25 points each, I pts total). Type of base change New codon New amino acid/translated Name of mutation type Transition Trai version #1 codon Transversion #2 Insertion of a TA base pair at the beginning of the

Explanation / Answer

A) As +1 indicates the start site ( coding region ) so the strand upstream it will be promoter which contain TATA box.Strand B is the template strand, non coding and antisense strand.

B) Transcribed mrna would be complementary to strand B:

5' UUCUAUAUGCACAUUUGCAAGUAA 3 '

C) AUG which is written in bold italics is start codon , upstream to it written in bold is 5 ' UTR and UAA is stop codon which is underlined.

D) translation will start from AUG that is start codon that encodes for methionine....

Methionine Histidine isoleucine cystine lysine

Related Questions

Navigate

• Browse (All)
• Browse D
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.