For your undergraduate research project you are investigating the function of th

Question

For your undergraduate research project you are investigating the function of the gene HSFI from S. cerevisiae. This gene encodes a heat shock transcription factor that is activated in a variety of stresses. You decide to perform a direct knock out of this gene in a trpl- haploid strain. To knock out HSF1 you insert the TRPI gene (with its promoter indicated by the arrow) from the pTRP1 plasmid into the yeast genomic DNA by homologous recombination so that you remove the HSF1 gene. The region of the TRPI gene and flanking 20bp in pTRP1 is showrn below SCCAAGCTCCCTTGCAATGGC 3' GGTTCGAGGGAACGTTACCG CCTACATTCCTAAGCCCACC" GGATGTAAGGATTCGGGTGG5 TRP1 Gene Design a forward and reverse primer (each 60 bases long) that will allow you to amplify the entire TRPI gene from pTRP1 and then subsequently use this PCR product to knock out the HSF1 gene Forward primer 5 Reverse primer 5' Hint! To design these primers you require the sequence flanking the TRP1 gene (see above) and the sequence flanking the TRPI ORF. To obtain the necessary information on TRPI follow the steps below 1) Go to the sgd website to obtain the HSF1 DNA sequence. Type HSF1 into the 'search'. 2) Go to 'Sequence', click on 'Download Sequence(fsa)' and select 'genomic DNA+/-lkb'. 3) You will see the entire sense strand of the HSFI ORF plus 1kb upstream and downstream of the ORF 4) Your forward and reverse primers must contain 40 bases immediately upstream and downstream of the gene, respectively, that you wish to knock out i)Find the 40 base sequence that is immediately upstream from the start codon (this sequence will start at base 960 (counting from the first base in the sequence you downloaded) and end at 1000 immediately before the start codon ATG) ii)Now find the 40 base sequence that is immediately downstream from the stop codon. This sequence will start 1000 bases before the LAST base in the sequence- i.e. the 40 base sequence starts with the first base AFTER the last base in the stop codon (TAA, TAG or TGA)

Explanation / Answer

I have just followed the steps that are given in the question

Forward primer 5 ' GTGAGTATACGTGATTAAGCACACAAAGGCAGCTTGGAGT ATGTCTGTTATTAATTTCAC 3'

Space is provided before the start codon

The sequence of the DNA at the 3' end

TC AAA AAT GCT AAG AAA TAG GTTATTACTGAGTAGTATTTATTTAAGTATTGTTTGTGCA

We need to have its reverse complement so that the primer should bind to the 3' end

So reverse primer is

5' TGCACAAACAATACTTAAATAAATACTACTCAGTAATAAC CTATTTCTTAGCATTTTTGA 3'

Space is provided before the stop codon

Related Questions

Navigate

• Browse (All)
• Browse F
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.