Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Find the primer binding sites and then calculate the size of the PCR product Are

ID: 210850 • Letter: F

Question

Find the primer binding sites and then calculate the size of the PCR product Are the primers perfect match for the DNA template? What happens if they aren't? Primer 1 5' -CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3 Primer 2 5' -AGGTTGGCTTGGTTTGCAATCATC-3" 1 gttcgttgca acaaattgat gagcaatgct tttttataat gccaactttg tacaaaaaag 61 ttggcaccat gttgactcta actcgcatcc gcactgtgtc ctatgaagtc aggagtacat 121 ttctgttcat ttcagtcctg gagtttgcag tggggtttct gaccaatgcc ttcgttttct 181 tggtgaattt ttgggatgta gtgaagaggc aggcactgag caacagtgat tgtgtgctgc 241 tgtgtctcag catcagccgg cttttcctgc atggactgct gttcctgagt gctatccagc 301 ttacccactt ccagaagttg agtgaaccac tgaaccacag ctaccaagcc atcatcatgc 361 tatggatgat tgcaaaccaa gccaacctct ggcttgctgc ctgcctcagc ctgctttact 421 gctccaagct catccgtttc tctcacacct tcctgatctg cttggcaagc tgggtctcca 481 ggaagatctc ccagatgctc ctgggtatta ttctttgctc ctgcatctgc actgtcctct 541 gtgtttggtg cttttttagc agacctcact tcacagtcac aactgtgcta ttcatgaata

Explanation / Answer

To find the binding site for the primer sequence:

Given primer 1: 5'-CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3'

Given primer 2: 5'-AGGTTGGCTTGGTTTGCAATCATC-3'

Given sequence:

GTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGACTCTAACTCGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCTGTTCATTTCAGTCCTGGAGTTTGCAGTGGGGTTTCTGACCAATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCAGGCACTGAGCAACAGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCCTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAACCACAGCTACCAAGCCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGCCTCAGCCTGCTTTACTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTGGCAAGCTGGGTCTCCAGGAAGATCTCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGCATCTGCACTGTCCTCTGTGTTTGGTGCTTTTTTAGCAGACCTCACTTCACAGTCACAACTGTGCTATTCATGAATA

STEPS:

Results:

No binding site is found between the given sequence and the primer.

The given sequence is found to be Synthetic construct Homo sapiens clone CCSBHm_00036375 TAS2R38 (TAS2R38) mRNA, encodes complete protein.

Primer is the complementary sequence to the template DNA strand that has to be amplified. It binds to the 3’ end of the template strand and synthesis of new DNA strand takes place. The given sequence does not have any complementary binding with the given primer sequences. When proper primer is not used the template DNA strand cannot be amplified using PCR.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote