I need an explanation of the monkeypox virus genome. The data took from analysis
ID: 204641 • Letter: I
Question
I need an explanation of the monkeypox virus genome. The data took from analysis of the monkeypox virus genome article.
https://ac.els-cdn.com/S0042682202914467/1-s2.0-S0042682202914467-main.pdf?_tid=f6d8df13-a9b2-4363-9ac0-e685ac6c8e06&acdnat=1520169411_9d47b5bea761430514386ca08ada121f
172 0042-6822/02 MONKEYPOX MRUS GENOME 173 Telomere Resolutios Target 82 GTTAG-TAAATT-AT-ATACATATAA-TTTTA-TA-ATTAAT-TTA-ATTITA GGTGACC-3 MPV-ZA ATTTAGTGTCY GrTAG-TAAATC-AT-ATACATATAA-TTTATA-ATTAAT-TA-ATTTTAGTOTCTAGAAAAAAOTORCAcC CTTAG-TANATT-AT-ATATATATAA-1TTTA TA-ATTAAT-TTA-ATTTTA ATCTATTTAGIGICTA CAATC ATTTAA TA TATATATATT AAAAT AT TAATTA AAT TAAAAT TAAATAAATCACAGATCTTTT VAC-COP VAC-WR CACACAGG-5 VAC COP FIG. 1. Comparison of the terminal region of MPV and other orthopoxviruses. Upper line shows the sequenced part of the MPV-ZAI termina oop. Sequences, which are necessary for telomere resolution, are boxed. Nucleotides, which differ from VAC-WR sequence, are printed in bold fon ZAL, BSH, and WR represent the virus strains Zaire-96-1-16, Bangladesh, and Western Reserve, respectively RESULTS AND DISCUSSION repetition (ITR) (Garon et al, 1978; Wittek et al., 1978), which includes a set of short tandem repeats (Wittek and Mos 1980) and terminal hairpins (Baroudy et al, 1982). Th The ends of orthopoxvirus genomes contain an identical MPV-ZAI genome contains a 6379-bp ITR. Using S1 nuc but oppositely oriented sequence called a terminal inverted ase hydrolysis and DNA polymerase I repair, we su Genome topographyExplanation / Answer
Alignment of MPV sequence with those of other orthopoxviruses indicated considerable conservation and suggested
that only the four nucleotides comprising the loop were missing (Fig. 1). Interestingly, the putative telomere resolution sequence of MPV (Fig. 1) is identical to that of VAC and VAR (Merchlinsky, 1990).
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.