Determine the primer sequences we must use for the M13 primers. The binding site

Question

Determine the primer sequences we must use for the M13 primers. The binding sites for these are shown as the M13 "FWD" site and the M13 "REV" site. So, provide the sequences written as 5' to 3' of the actual primers themselves. Keep in mind that extension from PCR primers comes from the 3' end (so that end must be "pointing" towards the cloning insertion site at the EcoR V cut site, also shown by pink box "Cloned DNA Insertion Site"). Think about what direction the DNA polymerase must extend a new strand from the primer and where the 5' and 3' ends or the primer would be. 15]

Explanation / Answer

Common primer sequences are-

M13 forward(-20) 5' GTAAAACGACGGCCAGT 3'

M13 forward (-40) 5'GTTTTCCCAGTCACGAC 3'

M13 reverse (-24) AACAGCTACGACCATG

M13 reverse (-48)AGCGGATAACAATTTCACACAGGA

DNA polymerase moves in direction of 3' to 5' ,the daughter strand is formed in 5' to 3' direction

KINDLY GIVE RATING

Related Questions

Navigate

• Browse (All)
• Browse D
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.