Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Background info: You have identified an organism with the smallest known genome

ID: 146529 • Letter: B

Question

Background info:

You have identified an organism with the smallest known genome (sequence below). You isolate the DNA and digest it with EcoR1

EcoRI --- 5' G AATTC 3'

5' ACGACGTATTAGAATTCTTATCCGCCGCCGGAATTCTCATCA 3'

3’ TGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’

Look for palindromic site, specific for restriction enzyme, each strand of the DNA is “cut” (phosphodiester bond of backbone is cleaved) at the same place in the sequence, this will produce sticky ends

The key steps in the experiment:

1. Extract DNA from organism (how would you do this, can you separate protein and nucleic acids, what about DNA from RNA)

2. Incubate DNA with restriction enzyme (what is you used the wrong enzyme? What if you accidentally boiled your sample?

3. Use gel electrophoresis to separate out DNA fragments by size (need a gel, need an electrical current, buffer)

4. Use Ethidium Bromide (EtBr) either in the gel or as a stain afterwards (this will allow for visualization of the DNA, non-specific, ring structure intercalates with bases, excited by UV light, emits orange light)

5. Include a ladder/controls – (you need ladder or something of known size if you want to estimate the size of the fragments)

6. Visualize with UV light source and imager

7. Important – maybe not as key - Use loading dye when loading DNA buffer (the buffer helps the DNA settle into the well, dye lets you approximate where the DNA should be in the gel as it is running)

______________________________________________________________________________________

Here is the question I would like to know:

1) What would happen if we changed something in the experiment?

A) What would happen if we changed step 1?

b) What would happen if we changed step 2?

c) What would happen if we changed step 3?

d) What would happen if we changed step 4?
e) What would happen if we changed step 5?

f) What would happen if we changed step 6?

g) What would happen if we changed step 7 (if anything) ?

Explanation / Answer

1.a

DNA cannot be extracted in the first step properly if it cannot be separated from proteins. In order to separate proteins from DNA, several proteases are required to digest protein present along with the DNA DNA is unaffected as proteases do not act on the DNA. Suppose we change this step for example if we do not use proteases in this step than DNA would not be able to extract properly as proteins will still be there attached to it.

b.

Restriction enzymes are the specific endonucleases which cleave inside the DNA at specific places. These places in DNA are usually palindromic, now if we use certain wrong enzymes then it will CLEAVE different places in DNA and that will produce different sticky oR different blunt ends for example, BamHI binds at the recognition sequence 5'-GGATCC-3' , and cleaves these sequences just after the 5'-guanine on each strand. If we use Hind III in its place then it will cleave and produce the different stretches of DNA as it cleaves the DNA palindromic sequencAAGCTT. Thus using specific restriction enzymes for the specific palindromic sequence is very important.

c.

The proper buffer is very important for the separation of DNA fragments during DNA separation. for example, Tris(hydroxymethyl) aminomethane, with a pKa of 8.1, is an effective buffer between pH 7 and 9. Because of its neutral range, tris is a commonly used buffer in biological labs. Now if we use another buffer at this pH range, this will create a problem in separation of DNA fragments because that buffer may have a different PH and accordingly DNA separation would not occur at that pH.

D.

Ethidium bromide is a valuable aid for visualizing DNA in gels, as it acts as a DNA interchelator, inserting itself into the spaces between the base pairs of the double helix. Ethidium bromide possesses UV absorbance maxima at 300 and 360 nm. Now ethidium Bromide has a particular UV absorbance, if we use another gel for staining DNA it may not work because it may not have that particular UV absorbance of 350 -3 60 NM and thus it could not serve as a valuable visual aid to watch DNA fragments.