You have access to a PCR machine and all the reagents, ( primers, Taq polymerase

Question

You have access to a PCR machine and all the reagents, (primers, Taqpolymerase etc). You do the PCR reaction on your unknown DNA and you sequenced the PCR product.

The sequence you obtain is the following:

CCGTACGATGCCAATGGTACTCCGGTTGATGTTGTCCTCAACCCGTTGGGCGTACCATCG CGTATGAACGTTGGTCAGATTCTTGAAACTCACTTGGGCCTTGCAGCCAAAGGGTTGGGC GAGAAGATCAACCTCATGATCGAGGAGCAGCGCAAGGTTGCAGACCTGCGTAAGTTCCTG CATGAGATCTACAACGAAATTGGCGGTCGTCAAGAAAGCCTGGATGACTTCTCTGATCAG GAAATTCTTGATCTGGCGAAGAACCTTCGCGGCGGTGTTCCTATGGCTACCCCGGTATTT GACGGTGCCAAGGAAAGCGAAATCAAGGCCATGCTGCGCTTGGCAGATCTGCCTGACAGC GGCCAGATGCAGCTGACTGACGGTCGTACCGGCAACAAGTTTGAGCGTCCGGTTACCGTT

What is your unknown?  

How did you come to that conclusion?

Explanation / Answer

PCR is a poweful technique used to investigate the presence of a particular type of DNA sequence in a given sample. Based upon amplification reaction and the amplicon so resulting, the nature of gene product can be investigated.

Here, the information states that all the reagents required for PCR along with a thermocyler are available. The seqeunce obtained after PCR is also available. However, the size of the PCR product is not known since a reference molecular weight ladder is absent in this case. Thus, a band will appear in the agarose gel but the size of the band cannot be ensured unless a reference ladder is present.

This conclusion is based upon the fact that all the primers are designed to amplify specific regions of the DNA. These reference regions are then identified based upon their molecular size. Thus, running and resolving a standard DNA sample along with a molecular weight ladder is utmost required in PCR experiment.

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.