Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse S

Alphabetical listing with fast deep pagination.
53166 items • Page 243 / 1064

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Select the best choice and write the letter for your choice in the box provided
Select the best choice and write the letter for your choice in the box provided In contrast to pointers, a reference in C++: a. must be initialized b. cannot have its value displa…
Select the best choice of detector for the specific type of spectroscopic applic
Select the best choice of detector for the specific type of spectroscopic application. Fill in the letter i) through vi) of your preferred choice in the blanks provided: A. Scanni…
Select the best choice of light source for the specific type of spectroscopic ap
Select the best choice of light source for the specific type of spectroscopic application. Fill in the letter i) through vi) of your preferred choice in the blanks provided. A. At…
Select the best choice that completes the question being asked. Open image in ne
Select the best choice that completes the question being asked. Open image in new tab for easy viewing if needed. Provide correct solutions to questions will result in positive fe…
Select the best choice that completes the question being asked. Open image in ne
Select the best choice that completes the question being asked. Open image in new tab for easy viewing if needed. Provide correct solutions to questions will result in positive fe…
Select the best definition for the each cost listed below: Costs that change in
Select the best definition for the each cost listed below: Costs that change in proportion to changes in volume of activity      The potential benefit lost by choosing a specific …
Select the best definition for wavelength. the rate at which electromagnetic wav
Select the best definition for wavelength. the rate at which electromagnetic waves oscillate the distance between two crests of an electromagnetic wave the oscillations of electri…
Select the best definitions of population and sample. A sample is the group from
Select the best definitions of population and sample. A sample is the group from whom information is being collected. A population is the larger group the sample represents. A pop…
Select the best match for each term below. A. The process used to control waterb
Select the best match for each term below. A. The process used to control waterborne pathogenic organisms and prevent waterborne disease. B. Any physical, chemical, or mechanical …
Select the best match for the following. is a valid identifier is a number witho
Select the best match for the following. is a valid identifier is a number without a fraction is an invalid identifier is a binary operator is a special symbol may be a unary or b…
Select the best match from the list below indicating the location of the specifi
Select the best match from the list below indicating the location of the specified structure or process (one answer per question; answers may be used more than once) ____ light-ca…
Select the best method for isolating a mesophilic, Gram-negative enteric capable
Select the best method for isolating a mesophilic, Gram-negative enteric capable of fermenting lactose. Perform isolation streak onto MSA, grow at 37C, select colonies that yellow…
Select the best name for the following molecules based on the IUPAC Select the n
Select the best name for the following molecules based on the IUPAC Select the name for the following best molecules based on the IUPAC (International Union of Pure and Applied Ch…
Select the best option that completes the statement asked. Open image in new tab
Select the best option that completes the statement asked. Open image in new tab for easy viewing if needed. Provide correct solutions to questions for guaranteed positive feedbac…
Select the best option(s) to complete the following sentence. Transcription in b
Select the best option(s) to complete the following sentence. Transcription in bacteria differs from transcription in a eukaryotic cell because... 1. RNA polymerase (along with it…
Select the best possible answer! 1. A special type of programming language used
Select the best possible answer! 1. A special type of programming language used to provide instructions to the monitor is __________. a) FPL b) JCL c) DML d) ASSEMEMBLER 2. "The p…
Select the best possible answer! 1. A(n) __________ is a set of resources for th
Select the best possible answer! 1. A(n) __________ is a set of resources for the movement, storage, and processing of data and for the control of these functions. a) Application …
Select the best possible answer! 2. When an external device becomes ready to be
Select the best possible answer! 2. When an external device becomes ready to be serviced by the processor the device sends a(n) _________ signal to the processor. a) Access b) Hal…
Select the best reagent or sequence of reagent from list provided which would be
Select the best reagent or sequence of reagent from list provided which would best accomplish each transformation below place the corresponding to the reagent(s) in the blank to t…
Select the best response from below. Assume that an investor currently holding s
Select the best response from below. Assume that an investor currently holding stock in Miller Corporation wants to add the stock of either Bud Corporation or Coors Corporation to…
Select the best response. Round 931,487 to four significant digits, then three s
Select the best response. Round 931,487 to four significant digits, then three significant digits, then two significant digits. A. Four significant digits – 931,400; three signifi…
Select the best response. The IRR and NPV investment criteria always result in t
Select the best response. The IRR and NPV investment criteria always result in the same accept or reject decision for an investment project. a. True b. False Corporate bonds are s…
Select the best term for each definition below. Each Term is used only once. ( s
Select the best term for each definition below. Each Term is used only once. ( select it carefully ! ) (100% stock dividend - Accumulated deficit- Growth stocks - PE ratio ). a. A…
Select the best term to complete the sentence. Ansers are either Udervalued or O
Select the best term to complete the sentence. Ansers are either Udervalued or Overvalued 1. Managemenr is likely to repurchase stock if it believes that the stock is ???, this se…
Select the best word or phrase that completes each of the following. (JAVA) Ever
Select the best word or phrase that completes each of the following. (JAVA) Every class is a [1] of the class [2] A or an [3][4] cannot be instantiated A class that is prefaced wi…
Select the best/correct statement below: Changing the duty cycle from 25% to 50%
Select the best/correct statement below: Changing the duty cycle from 25% to 50% will double the average power dissipated by the LED. The LED will appear twice as bright. Changing…
Select the best/correct statement below: Changing the duty cycle from 25% to 50%
Select the best/correct statement below: Changing the duty cycle from 25% to 50% will double the average power dissipated by the LED. The LED will appear twice as bright. Changing…
Select the better sentence, the one that does not have any problem of pronoun-an
Select the better sentence, the one that does not have any problem of pronoun-antecedent agreement. O A. An American family is likely to have at least two cars in their garage. O …
Select the big-O complexity for each operation/algorithm Question 1 options: Arr
Select the big-O complexity for each operation/algorithm Question 1 options: Array access B-tree insertion Selection Sort B-tree search dequeue operation Insertion Sort Stack push…
Select the boat answer or completion to each of the questions or incomplete stat
Select the boat answer or completion to each of the questions or incomplete statement 1. What is the voltage across the power supply in the circuit below. A. 1.6 V B. 16.0 V C. 8.…
Select the boat answer or completion to each of the questions or incomplete stat
Select the boat answer or completion to each of the questions or incomplete statement 1. What is the voltage across the power supply in the circuit below. A. 1.6 V B. 16.0 V C. 8.…
Select the chemical equilibrium that corresponds to K form for Ag(S 2 O 3 ) 2 3-
Select the chemical equilibrium that corresponds to Kform for Ag(S2O3)23-. Ag+(aq) + 2S2O33-(aq)? Ag(S2O3)23-(aq) Ag+(aq) + 2S2O32-(aq)? Ag(S2O3)23-(aq) Ag(S2O3)23-(aq)? Ag+(aq) +…
Select the chemical that matches each description below. Key: a. Angiotensin con
Select the chemical that matches each description below. Key: a. Angiotensin converting enzyme b. Antidiuretic hormone c. Aldosterone d. Angiotensin I e. Angiotensin II f. Atrial …
Select the choice below that best defines an image. Select One of the Following:
Select the choice below that best defines an image. Select One of the Following: You want to build a search light. The search light is to have an outgoing parallel beam. You have …
Select the choice from the list below that most accurately completes the stateme
Select the choice from the list below that most accurately completes the statements below. The first phrase will go in the first blank of the statement and the second phrase will …
Select the choice from the list below that most accurately completes the stateme
Select the choice from the list below that most accurately completes the statements below. The first phrase will go in the first blank of the statement and the second phrase will …
Select the choice that follows that best defines spherical symmetry. Select One
Select the choice that follows that best defines spherical symmetry. Select One of the Following: (a) A system has spherical symmetry if it is unchanged under any rotation (b) A s…
Select the choice that follows that best defines spherical symmetry. Select One
Select the choice that follows that best defines spherical symmetry. Select One of Following: (a) A system has spherical symmetry if it is unchanged uynder any rotation about its …
Select the choice that follows the describes the relation between electric force
Select the choice that follows the describes the relation between electric force on a charged particle and the direction of the electric field lines. Select One of the Following: …
Select the closest definition (or portion of a definition) for each term in the
Select the closest definition (or portion of a definition) for each term in the first column. Each definition may be used only once or not at all. Definition (or Portion) 1. A con…
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use to build your portfolio Explain the steps that would be needed for your selected portfolio company…
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use to build your portfolio Explain the steps that would be needed for your selected portfolio company…
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use to build your portfolio Explain the steps that would be needed for your selected portfolio company…
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use to build your portfolio Explain the steps that would be needed for your selected portfolio company…
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use
Select the company ( Walmart, Target, Kroger, Sears or Amazon) that you will use to build your portfolio Explain the steps that would be needed for your selected portfolio company…
Select the conclusions we could draw (select all that apply). a. People with mor
Select the conclusions we could draw (select all that apply). a. People with more debt tend to be more stressed. b. People with more debt tend to be less stressed. c. Debt and str…
Select the conclusions we could draw (select all that apply). a. People with mor
Select the conclusions we could draw (select all that apply). a. People with more debt tend to be more stressed. b. People with more debt tend to be less stressed. c. Debt and str…
Select the correct 18mer (18 bases long) reverse primer to amplify the DNA seque
Select the correct 18mer (18 bases long) reverse primer to amplify the DNA sequence comprised between the two bases indicated in red color and underlined. 5'GAATTCATGCGTAGATCGATGA…
Select the correct answer 1) The point estimator of the population proportion is
Select the correct answer 1) The point estimator of the population proportion is aSample Proportion b. Sample Standard Deviation c. Sample Mean 2) A 95% confidence interval for a …
Select the correct answer 1.All the following were developments of the Neolithic
Select the correct answer 1.All the following were developments of the Neolithic era except: agriculture pottery Urban cities Tool making 2.All of the following cases involving di…