Browse I

I have to write a C++ function called sort that will take in a reference to a ve

I have to write a C++ function called sort that will take in a reference to a vector and sort it in ascending order. This is my function so far, I just don't know how to sort it i…

I have to write a C++ function for Bubble and Selection sort algorithms for stri

I have to write a C++ function for Bubble and Selection sort algorithms for strings. Each function gets string as an argument and returns string array as output. #include<iostr…

I have to write a C++ program that computes COMPOUND INTEREST NOT SIMPLE INTERES

I have to write a C++ program that computes COMPOUND INTEREST NOT SIMPLE INTEREST, USING CONTROL STRUCTES; A NESTED LOOP(OUTER LOOP CONDITION IS NUMBER OF ACCOUNTS, INNER LOOP CON…

I have to write a C++ program that computes COMPOUND INTEREST not simple interes

I have to write a C++ program that computes COMPOUND INTEREST not simple interest, using control structures; a nested for loop and if else statements. Balance Rate overdrawn accou…

I have to write a C++ program that randomly generates the numbers 1-100 in an ar

I have to write a C++ program that randomly generates the numbers 1-100 in an array and then I have to find the number 77 using the sequential search and computer O(n). After that…

I have to write a C++ program that will ask the user to enter option c to \"chec

I have to write a C++ program that will ask the user to enter option c to "check out book" or d to "check in book" when c is enter, the program will ask the user to enter the book…

I have to write a C++ program thatcreates a stack of POINTs for up to 100 points

I have to write a C++ program thatcreates a stack of POINTs for up to 100 points, see class POINTfollowed by stack class below respectively. Basically I am facingtrouble passing a…

I have to write a Javascript function that checks a form from an online store wh

I have to write a Javascript function that checks a form from an online store when the submit button is pressed. It has to recognize a specific username and password.This part is …

I have to write a Technical Feasiblilty report for my charity, which is a non pr

I have to write a Technical Feasiblilty report for my charity, which is a non profit organization called Pennies for Pups. There are some grammar mistakes within the scope. I'm lo…

I have to write a class named Coin, which needs to have a String named sideUp wh

I have to write a class named Coin, which needs to have a String named sideUp which will hold either "heads" or "tails" indicating the side of the coin that is facing up. The Coin…

I have to write a class with specific parameters (in comment blocks) and this is

I have to write a class with specific parameters (in comment blocks) and this is what I have so far, but I am stuck... [code] /* * this type supports date/time timestamp objects f…

I have to write a client and server program,This is the question for the server

I have to write a client and server program,This is the question for the server program. (This is Java) PART B Server Program: 1. Maintain the following information using an appro…

I have to write a code based on the question, but I have no idea how to write it

I have to write a code based on the question, but I have no idea how to write it. EXERCISE In this problem, you will write a method that takes in two Strings representing a round …

I have to write a code determining if a number is a prime number or not, a perfe

I have to write a code determining if a number is a prime number or not, a perfect number or not. Output a list of all divisors of numbers that are not prime and a list of divisor…

I have to write a code for a maze. I have already completed to core of it. Howev

I have to write a code for a maze. I have already completed to core of it. However, I can't get the backtracking portion done. It checks to see if there is a '.' in the current lo…

I have to write a code for my comp sci class and I\'m having trouble with some i

I have to write a code for my comp sci class and I'm having trouble with some instructions given for my assignment. In my assignment we have to input three initials and length of …

I have to write a code for my comp sci class and I\'m having trouble with some i

I have to write a code for my comp sci class and I'm having trouble with some instructions given for my assignment. In my assignment we have to input three initials and length of …

I have to write a comparative research design paper and I\'m still not sure on h

I have to write a comparative research design paper and I'm still not sure on how I should write it. It has to include all of the following requirements below. Summary of Articles…

I have to write a complete program that prompts the user for a student’s status

I have to write a complete program that prompts the user for a student’s status and grade point average ( GPA ) and then I have to determine whether or not the student should be p…

I have to write a formal lab write. And I need primary references. Like Scientif

I have to write a formal lab write. And I need primary references. Like Scientific journals ,books, or a website (gov or edu websites) on the topic of Western Blot. Can someone he…

I have to write a function( public static int rec(String u,char p)) thattakes a

I have to write a function( public static int rec(String u,char p)) thattakes a string and character and returns the number of occurencesin the string. Heres what i have int blab=…

I have to write a guessing game Java program using exceptions. The program gener

I have to write a guessing game Java program using exceptions. The program generates a random number and the user must guess the number. Here are the requirements: -Program genera…

I have to write a java program . So basically I have to take my input in only cm

I have to write a java program . So basically I have to take my input in only cms. Inches is also accepted but the inches should be converted into the cms before the program take …

I have to write a loop program in c language that will ask for a number and send

I have to write a loop program in c language that will ask for a number and send that number from main to a function that determines if it is a narcassistic number. if it is the f…

I have to write a matlab script and I don\'t know where to start. The problem is

I have to write a matlab script and I don't know where to start. The problem is to: Write a MATLAB script RandomWalkC2D. The walker starts at the origin (x1,y1)=(0,0), and at each…

I have to write a method that will output the following: Please enter 10numbers:

I have to write a method that will output the following:         Please enter 10numbers: 5 3 2 8 14 22 5 3 20 3         Sum of numbers is:85         New array contents is: 86 5 11…

I have to write a modified version of a Rectangle class that makes use of a Poin

I have to write a modified version of a Rectangle class that makes use of a Point class to keep track of its location in an x/y coordinate system. Point Private: int x int y Publi…

I have to write a nested if statement for the sam 2010 project 4. The requests i

I have to write a nested if statement for the sam 2010 project 4. The requests is as following: In cell E12, use nested IF functions to display the shipping costs for the option e…

I have to write a new class that prints out after each individuals \"Paid: blah\

I have to write a new class that prints out after each individuals "Paid: blah" line that says "Vacation: blah" so I need a new public class Vacation that will print out these sta…

I have to write a paper based on a set of interview questions. No one was willin

I have to write a paper based on a set of interview questions. No one was willing to answer these for me, so I am turning to you! This paper is due tomorrow April 23, 2017. The qu…

I have to write a paper on a change-agent interview. I have the question, but th

I have to write a paper on a change-agent interview. I have the question, but the syllabus does not give me an example of the paper. Not sure if the professor is asking for the tr…

I have to write a paragraph for each of the following points. My specific projec

I have to write a paragraph for each of the following points. My specific project hypothesis is: If I increase the temperature in water, then sugar will dissolve faster. 1. Descri…

I have to write a polynomial class linked list program and i do not know what is

I have to write a polynomial class linked list program and i do not know what is wrong with my code. Can someone please help. It is about adding, multiplying and subtraction polyn…

I have to write a program in c that implements binary heaps. I am not too sure w

I have to write a program in c that implements binary heaps. I am not too sure where to start. Objective By completing this assignment, students will demonstrate a working knowled…

I have to write a program in java to compute the standard deviation and the mean

I have to write a program in java to compute the standard deviation and the mean. I am also to write a test program that will prompt the user to enter 10 numbers and display the m…

I have to write a program in java to compute the standard deviation and the mean

I have to write a program in java to compute the standard deviation and the mean. I am also to write a test program that will prompt the user to enter 10 numbers and display the m…

I have to write a program that reads a student’s nametogether with his or her te

I have to write a program that reads a student’s nametogether with his or her test scores. The program should thencompute the average test score for each student and assign a grad…

I have to write a program that reads a student’s nametogether with his or her te

I have to write a program that reads a student’s nametogether with his or her test scores. The program should thencompute the average test score for each student and assign a grad…

I have to write a program that takes a string input, prints the frequency of eac

I have to write a program that takes a string input, prints the frequency of each character and also prints the string in reverse. I think I got how to print the frequency, but I …

I have to write a program that will calculate the heat transfer of a substance (

I have to write a program that will calculate the heat transfer of a substance (water) given three different shapes. The user has to be able to input the type of shape, so that th…

I have to write a program that will determine the perfectnumbers between 5 and 5

I have to write a program that will determine the perfectnumbers between 5 and 500 and also determine the prime numbersbetween 10 and 300. i'm supposed to use the prototypes: bool…

I have to write a program that works with a user\'s password. The program will p

I have to write a program that works with a user's password. The program will prompt the user for a possible password. The program should check to be sure this is a 'good' passwor…

I have to write a program to solve the problems givenbelow: 1. Read a set of thr

I have to write a program to solve the problems givenbelow: 1. Read a set of three numbers from keyboard and determine themiddle of three numbers. For instance, if the numbers are…

I have to write a program using files that creates an input and output file. I h

I have to write a program using files that creates an input and output file. I have a program below written using pointers, but unfortunately I can't use pointers since I havent l…

I have to write a python script that splits this numbers.csv.gz into 10 new file

I have to write a python script that splits this numbers.csv.gz into 10 new files the files are based off of column B where column has ordered integers 1-10. I need to write a pyt…

I have to write a quick sort code that Divide: pick a random element x (called p

I have to write a quick sort code that Divide: pick a random element x (called pivot) Using x, partition S (the list to sort) into: L: elements less than x E: elements equal x G: …

I have to write a reduce method ( as seen below) I have the method all written o

I have to write a reduce method ( as seen below) I have the method all written out, I am just unsure how to call it in the constructor and mutators. I will include a copy of my co…

I have to write a report on the this sequence: ACCACTGTTTGGAGCACTTGGTGCAGTACC Th

I have to write a report on the this sequence: ACCACTGTTTGGAGCACTTGGTGCAGTACC The common website used to help answer these questions is: http://www.ncbi.nlm.nih.gov could you plea…

I have to write a report on the this sequence: ACCACTGTTTGGAGCACTTGGTGCAGTACC Th

I have to write a report on the this sequence: ACCACTGTTTGGAGCACTTGGTGCAGTACC The common website used to help answer these questions is: http://www.ncbi.nlm.nih.gov could you plea…

I have to write a research paper for a technical class. The research paper needs

I have to write a research paper for a technical class. The research paper needs to have an abstract. I am confused about how to format the spacing. For example, I know that I hav…