I have to write a report on the this sequence: ACCACTGTTTGGAGCACTTGGTGCAGTACC Th
ID: 169262 • Letter: I
Question
I have to write a report on the this sequence: ACCACTGTTTGGAGCACTTGGTGCAGTACC The common website used to help answer these questions is: http://www.ncbi.nlm.nih.gov could you please explain how to get these answer as well. Thanks 1. Identify the gene from which the query sequence originates (Name of gene) 2. Provide the FULL protein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein. 6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference. 7. Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue). 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene. 9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homologue). 10. Generate a secondary structure prediction for one identified protein.
Explanation / Answer
1. The gene name is Papio anubis interleukin 2 receptor subunit gamma (IL2RG). the blast of that sequence show 100 percent sequence similarity with this protein.
2. The full sequence of the amino acid for this protein which is 370 amino acid.
3. Yes there are two different splice variant known for this protein which are produced by alternative splicing.
isoform 1 is canonical sequence and isoform 2 have these variation 1-8: MLKPSLPF MGMKTPQL and
9-198 amino acids are missing.
4. severe combined immunodeficiency (SCID) a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.