Browse 0-9
Alphabetical listing with fast deep pagination.
131141 items • Page 225 / 2623
1) You need to produce a buffer solution that has a pH of 5.33. You already have
1) You need to produce a buffer solution that has a pH of 5.33. You already have a solution that contains 10. mmol (millimoles) of acetic acid. How many millimoles of acetate (the…
1) You own 6 songs by Adele, 4 by Katy Perry, and 5 by Lady Gaga. How many diffe
1) You own 6 songs by Adele, 4 by Katy Perry, and 5 by Lady Gaga. How many different playlists can you make that consist of 4 Adele songs, 3 Perry songs, and 2 Gaga songs, if you …
1) You own a mechanically ventilated swine facility. The dry bulb temperature in
1) You own a mechanically ventilated swine facility. The dry bulb temperature inside the facility is 50 degrees F and outside is only 30 degrees F. Inside you have a relative humi…
1) You own a stock portfolio invested 15 percent in Stock Q, 33 percent in Stock
1) You own a stock portfolio invested 15 percent in Stock Q, 33 percent in Stock R, 40 percent in Stock S, and 12 percent in Stock T. The betas for these four stocks are 1.4, .5, …
1) You own an annuity plan that gives you the freedom to change the amount of co
1) You own an annuity plan that gives you the freedom to change the amount of contributions, stop contributions, and resume them at will. This plan is called: single premium defer…
1) You perform the following regression: Studentw = –229.92 – 6.52 × Female + 0.
1) You perform the following regression: Studentw = –229.92 – 6.52 × Female + 0.51 × Sibs+ 5.58 × Height, R2=0.50, SER = 21.08 where Studentw is in pounds, Height is in inches, Fe…
1) You perform the following regression: Studentw = –229.92 – 6.52 × Female + 0.
1) You perform the following regression: Studentw = –229.92 – 6.52 × Female + 0.51 × Sibs+ 5.58 × Height, R2=0.50, SER = 21.08 where Studentw is in pounds, Height is in inches, Fe…
1) You place a 50mL of 0.50M NaOh and 25mL of 0.50M HCl in a coffee cup calorime
1) You place a 50mL of 0.50M NaOh and 25mL of 0.50M HCl in a coffee cup calorimeter. What is the final temperature of the calorimeter if the initial temperature of the solution is…
1) You play a game in which the probability of winning is 24 percent. If you win
1) You play a game in which the probability of winning is 24 percent. If you win, you win 4 dollars and if you lose, you lose 2 dollars. In 80 plays, you will lose _____ dollars, …
1) You prepare a stock solution (highly concentrated) of sugar water with a conc
1) You prepare a stock solution (highly concentrated) of sugar water with a concentration of 500 mg/ml. You need to make a new solution that is half as concentrated and has a fina…
1) You prepared 2 plasmids by a mini-prep method, diluted the final solutions 1:
1) You prepared 2 plasmids by a mini-prep method, diluted the final solutions 1:50, and using a spectrophotometer and standard cuvette, you determined the UV absorbances at 260…
1) You purchased 580 shares of stock at a price of $59.37 per share. Over the la
1) You purchased 580 shares of stock at a price of $59.37 per share. Over the last year, you have received total dividend income of $680. What is the dividend yield? 1.2 percent a…
1) You purchased a machine for $500,000 (installed), and you depreciated it usin
1) You purchased a machine for $500,000 (installed), and you depreciated it using a 5 year MACRS. This machine generates $200,000 in annual revenue. In year 4, you sold the machin…
1) You purchased a machine for $500,000 (installed), and you depreciated it usin
1) You purchased a machine for $500,000 (installed), and you depreciated it using a 5 year MACRS. This machine generates $200,000 in annual revenue. In year 4, you sold the machin…
1) You read a paper that says, “The symbiotic alpha-proteobacterium that first t
1) You read a paper that says, “The symbiotic alpha-proteobacterium that first took up residence in an early eukaryote would have had a genome that codes for at least 500 proteins…
1) You run an internet startup company from your home. You have solar panels ins
1) You run an internet startup company from your home. You have solar panels installed in your home which generate electricity that you sell to the local electric company any time…
1) You sent off a sample for sequencing in order to aid in prescribing the prope
1) You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back: a. TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCG…
1) You sequence a gene of interest and isolate the matching mRNA. You find that
1) You sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that? a) There was an experimental m…
1) You shine both red and blue light through a double slit. What can you say abo
1) You shine both red and blue light through a double slit. What can you say about their interference patterns? A) The blue bright fringes will be closer together than will be the…
1) You shorted 160 shares of T for $97. You closed this position when T was trad
1) You shorted 160 shares of T for $97. You closed this position when T was trading for $94. What is the profit (in $) of this transaction? Ignore the effects of margin. 2)You bou…
1) You study a deadly disease in your community; Methicillin-resistant Staphyloc
1) You study a deadly disease in your community; Methicillin-resistant Staphylococcus aureus (MRSA). It is usually contracted in in-patient facilities. The following information w…
1) You take some data with Nichrome wire and you have a plot of R vs. LA -1 with
1) You take some data with Nichrome wire and you have a plot of R vs. LA-1 with the following equation from your computer y = 0.999 * x + 1.1. Someone gives you the same wire with…
1) You throw a stone vertically upward, and it feels no air resistance. Once it
1) You throw a stone vertically upward, and it feels no air resistance. Once it is free of your hand but moving upward, the two forces acting on it are the downward pull of gravit…
1) You throw a stone vertically upward, and it feels no air resistance. Once it
1) You throw a stone vertically upward, and it feels no air resistance. Once it is free of your hand but moving upward, the two forces acting on it are the downward pull of gravit…
1) You use the Bradford (coomassie) assay to determine the concentration of a wh
1) You use the Bradford (coomassie) assay to determine the concentration of a whey protein. You use bovine albumin as your standard. You determine the histone protein concentratio…
1) You use your hand to stretch a spring to a displacement x from its equilibriu
1) You use your hand to stretch a spring to a displacement x from its equilibrium position and then slowly bring it back to that position. Which is true? a) The spring's change in…
1) You want to buy a generator for your house that can power your refrigerator,
1) You want to buy a generator for your house that can power your refrigerator, a space heater, and be able to charge your cell phone. What size generator would you buy and why? G…
1) You want to design an oval racetrack such that 3200 lb racecars can round the
1) You want to design an oval racetrack such that 3200 lb racecars can round the turns of radius 1000 ft at 103 mi/h without the aid of friction. You estimate that when elements l…
1) You want to design an oval racetrack such that 3200 lb racecars can round the
1) You want to design an oval racetrack such that 3200 lb racecars can round the turns of radius 1000 ft at 103 mi/h without the aid of friction. You estimate that when elements l…
1) You will develop a library module of C functions which operate on floating po
1) You will develop a library module of C functions which operate on floating point values using only integer operations. The library module will include the functions listed belo…
1) You will receive a DNA sample labelled A, B, C, or D. Make a 50-fold dilution
1) You will receive a DNA sample labelled A, B, C, or D. Make a 50-fold dilution of your sample and measure the absorbance at 260 nm. Calculate the concentration of your sample. S…
1) You will use a stack and a queue to implement a scrambled version of the rota
1) You will use a stack and a queue to implement a scrambled version of the rotational hashing function in Java. Before applying the rotational hash to the string, you will implem…
1) You would expect to find Ran-GAP in the _________ and Ran GEF in the ________
1) You would expect to find Ran-GAP in the _________ and Ran GEF in the __________ A. cytoplasm, nucleus B. nucleus, cytoplasm C. cytoplasm, cytoplasm D. nucelus, nucleus 2)The fo…
1) You\'ll respond with brief descriptions showing how two of the things on the
1) You'll respond with brief descriptions showing how two of the things on the list are not like the other one. 3 Things: Star Trek, Star Wars, Doctor Who 2/In your post, choose o…
1) You\'re an undercover biological weapons agent who has been given an unknown
1) You're an undercover biological weapons agent who has been given an unknown liquid - you suspect that it is just sugar water (because you drank some by accident - you know you'…
1) You\'re in a research lab and have one sample of 50.55uM of 1% MgOH2 that mus
1) You're in a research lab and have one sample of 50.55uM of 1% MgOH2 that must be tested.Your assay kit gives a range of 3-15nmol. Review the following protocol and decide wheth…
1) You\'re in a research lab and have one sample of 50.55uM of 1% MgOH2 that mus
1) You're in a research lab and have one sample of 50.55uM of 1% MgOH2 that must be tested.Your assay kit gives a range of 3-15nmol. Review the following protocol and decide wheth…
1) You\'re investigating an oil spill for your state environmental protection ag
1) You're investigating an oil spill for your state environmental protection agency. There's a thin film of oil on water, and you know its refractive index is 1.32. You shine whit…
1) Your accountants tell you that it costs $400 to set up an immunization progra
1) Your accountants tell you that it costs $400 to set up an immunization program at a preschool and immunize one child against polio. It will cost $460 to immunize 20 more childr…
1) Your are sitting in your car, which is standing at the side of the road with
1) Your are sitting in your car, which is standing at the side of the road with the engine idling. In the rearview mirror, you see one of your class mates approaching on a bicycle…
1) Your beginning salary as an analyst in the HIM department is $12.50 per hour.
1) Your beginning salary as an analyst in the HIM department is $12.50 per hour. You are due to receive a 3.5 percent cost of living adjustment (raise) in your next paycheck. Your…
1) Your brother-in-law bought a piece of property 15 years ago for $29,000. He j
1) Your brother-in-law bought a piece of property 15 years ago for $29,000. He just sold it for $50,000, and spent the week-end bragging about his real-estate acumen. As a reality…
1) Your company currently sells oversized golf clubs. The Board of Directors wan
1) Your company currently sells oversized golf clubs. The Board of Directors wants you to look at replacing them with a line of super-sized clubs. Briefly explain whether the …
1) Your company has designed a new product and provided you with an appropriate
1) Your company has designed a new product and provided you with an appropriate test vehicle for you to address the question of fatigue: In use the product will vary in temperatur…
1) Your company is considering a new project that will require $945,000 of new e
1) Your company is considering a new project that will require $945,000 of new equipment at the start of the project. The equipment will have a depreciable life of 10 years and wi…
1) Your company is considering two mutually exclusive projects whose costs and n
1) Your company is considering two mutually exclusive projects whose costs and net cash flows are shown below. The projects are equally risky, their cost of capital is 12% and int…
1) Your company is evaluating two cloud-based secured data storage services. “Pi
1) Your company is evaluating two cloud-based secured data storage services. “Pie in the Sky,” the newer service, claims its uploading and downloading speeds are faster than the o…
1) Your company\'s stock sells for $150 per share, its last dividend was $3.00 p
1) Your company's stock sells for $150 per share, its last dividend was $3.00 per share, and its growth rate is 4%. What is the stock's required rate of return? (2)What is the sto…
1) Your factory has been offered a contract to produce a part for a new printer.
1) Your factory has been offered a contract to produce a part for a new printer. The contract would last for 3 years and your cash flow from the contract would be $4.88 million pe…
1) Your firm has been providing long term care insurance (covering nursing home
1) Your firm has been providing long term care insurance (covering nursing home care) for your workers. It costs the firm $2200 per year per employee to provide this benefit. Supp…