Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Web development and programming

191828 questions • Page 3805 / 3837

where a student is a person. A person has a first name (string), a last name (st
where a student is a person. A person has a first name (string), a last name (string), and age (int). A student has a major (string), a department (string), and a year admitted (i…
where can I find the answers to the case studies or would anyone answer the \"wr
where can I find the answers to the case studies or would anyone answer the "write a function procedure to calculate and return the sales tax" part for me? My instructor wants me …
where can I find: exploit module reference and payload module reference---for ex
where can I find: exploit module reference and payload module reference---for example- http://www.offensive-security.com/metasploit-unleashed/Auxiliary_Module_Reference#Admin    p…
where t is the time in seconds and y(t) is the blood pressure. Create an array f
where t is the time in seconds and y(t) is the blood pressure.  Create an array for time that goes from 0 to 0.5 seconds in increments of 0.0025 seconds.  Calculate the blood pres…
whether it accepted all inputs. This is where we proved the non-existence of M T
whether it accepted all inputs. This is where we proved the non-existence of M To some extent, this isn't too surprising since there are infinitely many possible input strings, an…
whew okay this one is wayy over my head... if someone actually can answer this,
whew okay this one is wayy over my head... if someone actually can answer this, i'll be more than grateful Let X(1..n) and Y(1..n) contain two lists of integers, each sorted in no…
which choices are correct? If M is a multi-tape Turing Machine, there is some st
which choices are correct? If M is a multi-tape Turing Machine, there is some standard Turing Machine, M', that is equivalent to M. always sometimes never Which of the following s…
which command is used in vi to quit without saving changes? What do the 1 and s
which command is used in vi to quit without saving changes? What do the 1 and s stand for in the following permission indicators? 1rwxrw-rw- srwxrwxrwx What permissions are applie…
which contains a skeleton of the solution. You should complete thisskeleton (i.e
which contains a skeleton of the solution. You should complete thisskeleton (i.e., complete all the methods) without modifying what isalready there. By the way, the skeleton will …
which get and exec ute the next user-specific command A system program a. system
which get and exec ute the next user-specific command A system program a. system cajk b. command interpreter windo Co A process state in which the process is waiting t a. waiting …
which of the 16 possible 2-mers has the highest value of totalDistance(v,DNA) fr
which of the 16 possible 2-mers has the highest value of totalDistance(v,DNA) from the DNA sequence ? cctgatagacgctatctggctatcc cc ac tt gc 10 points    QUESTION 2 Instead of four…
which of the following are equivalent to the statement Cats are smarter than dog
which of the following are equivalent to the statement Cats are smarter than dogs a. Some cates are smarter than some dogs b. There is a cat that is smarter than all dogs c. All c…
which of the following can be used in a Java program as identifiers? double 42 i
which of the following can be used in a Java program as identifiers? double 42 is The Answer for first-name AnnualSalary hello sum of data average Name the six errors in the follo…
which of the following can be used in a Java program as identifiers? double 42 i
which of the following can be used in a Java program as identifiers? double 42 is The Answer for first-name AnnualSalary hello sum of data average Name the six errors in the follo…
which of the following factor × Faculty information-NV260K1\"The Short Run, An u
which of the following factor × Faculty information-NV260K1"The Short Run, An unexpe isp?course.assessment,ids 3406552 18course.jd 1102157 18content.jid 111048624 1&step-nul; …
which of the following is used to allow load and store instructions multiple acc
which of the following is used to allow load and store instructions multiple access mechanisms into the memory system, many of which have patterns common in software algorithms. A…
which of the following statement(s) is(are) false regarding the PC1602F LCD? It
which of the following statement(s) is(are) false regarding the PC1602F LCD? It can be used in 4-bit mode. In which case only the lower 4 bits of the data bus (DB3-DB0) are connec…
which of the following statement(s) is(are) true regarding SPI? SPI is very simp
which of the following statement(s) is(are) true regarding SPI? SPI is very simple and takes less connections, hence cheap with small silicon footprint. It supports address. In a …
which of the following statements accurately describes how a modem works? (SELEC
which of the following statements accurately describes how a modem works? (SELECT TWO) a) it communicates over telephone network using digital signals. b) it modulates digitial da…
which of the following statements is true in regards to the update statement Con
which of the following statements is true in regards to the update statement Consider the following TSQL update statement: UPDATE EMPLOYEES SET EMPLOYEES.SALARY = PAYROLL.SALARY F…
which of the statements are true? a) any java object can be a runnable. b) metho
which of the statements are true? a) any java object can be a runnable. b) method notifyAll() moves all threads is from wait to run state. c) two different threads can be actively…
which of these threats to digital security is often overlooked? why is the inter
which of these threats to digital security is often overlooked? why is the internet so susceptible to cyber crime? what was the first piece of malware inserted into the internet? …
which of these threats to digital security is often overlooked? worms disgruntle
which of these threats to digital security is often overlooked? worms disgruntled employees or viruses why is the internet so susceptible to cyber crime? it's open architecture if…
which post office potentially serves the greatest number of people based on the
which post office potentially serves the greatest number of people based on the block group population data? which serves the least? (Note: the post office locations are one of th…
which sorts the rows of a given 2D array M with respect to (w.r.t.) the values i
which sorts the rows of a given 2D array M with respect to (w.r.t.) the values in a given column c. Hint: You can simply use the selection sort strategy over the given column c. T…
which statement about trees is false O A tree is a non-linear, two-dimensional d
which statement about trees is false O A tree is a non-linear, two-dimensional data structure. Tree nodes contain two or more links. O Binary tree nodes contain two or fewer links…
which we have started implementing a BinarySearchTree class that implements the
which we have started implementing a BinarySearchTree class that implements the Set interface. To make the code remove an element from the binary search tree easier, I wrote delet…
which we have started implementing a BinarySearchTree class that implements the
which we have started implementing a BinarySearchTree class that implements the Set interface. To make the code remove an element from the binary search tree easier, I wrote delet…
which we have started implementing a BinarySearchTree class that implements the
which we have started implementing a BinarySearchTree class that implements the Set interface. To make the code remove an element from the binary search tree easier, I wrote delet…
while loops Modify the program you wrote for the previous exercise so that it ke
while loops Modify the program you wrote for the previous exercise so that it keeps reading positive integers and classifying them as ODD or EVEN until the user inputs -1. No clas…
while rings >0: b. Write a function shoot that simulates firing an arrow towards
while rings >0: b. Write a function shoot that simulates firing an arrow towards the target. The effect of shoot should be to indicate visually where on the target (or near the…
while(divA != -1) { cout
while(divA != -1) { cout <<"Enter amounts of dividends, or enter -1 to quit:" << endl; cin >>divA; dividend[0] +=divA; } dividend[0] +=1; div1.setDividend(divide…
who could help me about these sevens SQL problem?? they are using see tables and
who could help me about these sevens SQL problem?? they are using see tables and relationship. Thanks!! Customer Belongs to Region Project Region ID Holds Customer Na Eon-Name 1 P…
whrit program in java to implement the shortest- path Dijkstra\'s algorithm if w
whrit program in java to implement the shortest- path Dijkstra's algorithm if we have: Graph.java import java.util.ArrayList; import java.util.Comparator; import java.util.HashMap…
why am I getting a syntax error in while principal! = -1 #include int
why am I getting a syntax error in while principal! = -1 #include <stdio.h> int main() { //declare variables for the interest calculator double principal = 0; double rate = …
why am i getting this error: error: cannot find symbol if((username==user_name)
why am i getting this error: error: cannot find symbol          if((username==user_name) && (password == hashed_password))                                       ^ symbol: …
why do I recive a cannot find symbol - variable outputStream in this line output
why do I recive a cannot find symbol - variable outputStream in this line outputStream = new PrintWriter( new FileOutputStream("numbered.txt")); this is the whole code import java…
why does the slideshow not work?
why does the slideshow not work? <!DOCTYPE html> <html> <head> <meta charset="utf-8"> <title>Final Project</title> <script> var timer_on=…
why does these errors keep coming up in code?? (71) warning C4715: \'openFile\'
why does these errors keep coming up in code?? (71) warning C4715: 'openFile' : not all control paths return a value and (80) warning C4700: uninitialized local variable 'ch' used…
why does this cause an error? CREATE OR REPLACE TRIGGER mm_return_trg AFTER UPDA
why does this cause an error? CREATE OR REPLACE TRIGGER mm_return_trg AFTER UPDATE OF checkin_date ON mm_rental /* After: helps define timing of trigger. UPDATE: event causing tri…
why doesn\'t my menu button work anymore
why doesn't my menu button work anymore <!DOCTYPE html> <html> <head> <meta charset="utf-8"> <title>Video library</title> <script> functi…
why doesn\'t the else condition ever work when I enter this code. I purposefully
why doesn't the else condition ever work when I enter this code. I purposefully put in a actual current weight that is GREATER than the biweekly goal weight but it doesn't go to t…
why im getting an error when entering pig in my hadoop server ? it should be lik
why im getting an error when entering pig in my hadoop server ? it should be like this below, job state job mapred id: joh 1522258068558 803 job message: just initialized job has …
why is my code crashing because of line : dev = dev + pow(value[i] - mean,2) ??
why is my code crashing because of line : dev = dev + pow(value[i] - mean,2) ?? ???? #include <cstdlib> #include <iostream> #include <fstream> #include <cmath…
why is my html file not picking up the javascript file, when i open the html on
why is my html file not picking up the javascript file, when i open the html on a browser it displays a blank page. my javascript file name is game.js html code is on bottom of th…
why is my regular expression not matching? I keep getting errors. the first line
why is my regular expression not matching? I keep getting errors. the first line in the file is a=b+4 import re #def main ( ) : line 1 charlist = [] tokenlist[ outlist = [] analyz…
why is the formatting not identical between what is displayed when I execute my
why is the formatting not identical between what is displayed when I execute my code in visual studios and it displays on the console versus what is displayed in the output.txt fi…
why is the output for the following snippet of code 20 30 40 40 30 20 61 60 20 2
why is the output for the following snippet of code 20 30 40 40 30 20 61 60 20 20 30 61 ? ---------------------------------------... int foo(int &a, int b, int &c) { cout …
why my lexical analyzer displaying indentifer, when all of the variables are not
why my lexical analyzer displaying indentifer, when all of the variables are not indentifer in the dat file in java. import static java.io.StreamTokenizer.TT_EOF; import static ja…
why the Dijkstra Algoritm does not give reliable results if there are negative e
why the Dijkstra Algoritm does not give reliable results if there are negative edges? Paper must discuss how the Dijkstra algoritm works and include these items below Paper must g…