Chemistry concepts and calculations

5. Which of the following reactions is a redox reaction? (a) K2CrO4 + BaCl2 ? Ba

5. Which of the following reactions is a redox reaction? (a) K2CrO4 + BaCl2 ? BaCrO4 + 2KCl (b) Pb22+ + 2Br- ? 2PbBr (c) Cu + S ? CuS The answer sheet says just C, but shouldn't i…

5. Which of the following statements regarding the difference between an average

5. Which of the following statements regarding the difference between an average rate and an instantaneous rate is NOT correct? a. The average rate is taken over a larger time per…

5. Which of the following students obtained precise but not accurate measurement

5. Which of the following students obtained precise but not accurate measurements? Carmen Chasbry Chery (B) Cynthia (C) Carmen (D) Chastity (A) Cheryl What is the percent relative…

5. Which of the two solutions below has a higher buffering capacity? Explain why

5. Which of the two solutions below has a higher buffering capacity? Explain why one solution has a better ability to resist changes in pH. (Hint: Consider what makes a good buffe…

5. Which of these would cause a gas volume increase if all else was held constan

5. Which of these would cause a gas volume increase if all else was held constant? a. Pressure increase b. Pressure decrease c. Temperature decrease d. Moles decrease 6. If 2 mole…

5. Which one of the following statements about atomic structure and quantum numb

5. Which one of the following statements about atomic structure and quantum numbers is incorrect? A) In a given atom, the maximum number of electrons having a principal quantum nu…

5. Which region of the electromagnetic spectrum contains photons of higher energ

5. Which region of the electromagnetic spectrum contains photons of higher energy? A) IR B) radio C) UV D) microwave E) red light 8. What form of electromagnetic radiation is used…

5. Which, if any, of the following statements partially or fully explain why chl

5. Which, if any, of the following statements partially or fully explain why chlorobenzene is an ortho, para director yet is a deactivator? Circle your answer. (3 points) a. The c…

5. Why is a burn from 373K steam more severe than a burn from 373K water? 6. Cal

5. Why is a burn from 373K steam more severe than a burn from 373K water? 6. Calculate the energy (heat) required to transform 18.02 g ice at 253K into steam at 393K. 7. Why is it…

5. With 47 proton and 46 electron, the symbol becomes, d. Ag+ 6.radiation requir

5. With 47 proton and 46 electron, the symbol becomes, d. Ag+ 6.radiation required lead or thick concreate is, c. gamma rays 7. radioactive decay follows first order kinetics deca…

5. Would a liquid with high vapor pressure be more likely to be in liquid statio

5. Would a liquid with high vapor pressure be more likely to be in liquid stationary phase or gas phase? Why? likely to be 6. When analyzing a GC spectra, you must mark a) your (b…

5. Would a liquid with high vapor pressure be more likely to be in liquid statio

5. Would a liquid with high vapor pressure be more likely to be in liquid stationary phase or gas phase? Why? likely to be 6. When analyzing a GC spectra, you must mark a) your (b…

5. Would a molecule of methane (CH,) be affected by the presenc Q6. lodine is a

5. Would a molecule of methane (CH,) be affected by the presenc Q6. lodine is a diat Q7 Compounds formed from only carbon and hydrogen (called hydrocarbons) are oft e of an electr…

5. Write a SELECT statement that returns the product_name and list_price columns

5. Write a SELECT statement that returns the product_name and list_price columns from the Products table. Return one row for each product that has the same list price as another p…

5. Write a function to compute the following where C(n, i) is the number of ways

5. Write a function to compute the following where C(n, i) is the number of ways to select i items out of n items. Assume that the following function is already written, tested an…

5. Write a method public char checkWinner(char grid) to identify the winner from

5. Write a method public char checkWinner(char grid) to identify the winner from a given game state in a TicTacToe game. The game is played on a square grid of size at least 3 x 3…

5. Write a method public char checkWinner(char[] [] grid) to identify the winner

5. Write a method public char checkWinner(char[] [] grid) to identify the winner from a given game state in a TicTacToe game. The game is played on a square grid of size at least …

5. Write a program that computes the prime factorization of a positive integer n

5. Write a program that computes the prime factorization of a positive integer number. The number in question is computed as the product of prime numbers raised to various exponen…

5. Write a program that creates an array of integers called data of size 100 usi

5. Write a program that creates an array of integers called data of size 100 using malloc; then, set data[100] to zero. What happens when you run this program? What happens when y…

5. Write solubility product expressions for the following compounds. a.) K 2 CrO

5.         Write solubility product expressions for the following compounds. a.)        K2CrO4                                                b.)        Ca3(PO4)2 c.)        Ca(OH…

5. Write the IUPAC name of a) triethylamine b) acetamide 6. a) Write a chemical

5. Write the IUPAC name of a) triethylamine b) acetamide 6. a) Write a chemical equation that explains the observations on the heating of benzamide with NaOH b) Write a chemical e…

5. Write the chemical formula for the chemicals listed below. Check your spellin

5.   Write the chemical formula for the chemicals listed below. Check your spellings. i)              Nitrous acid. ii)             Sodium bromite iii)            Cyanic acid iv) …

5. You are about to purchase a new system, and you are deciding between two almo

5. You are about to purchase a new system, and you are deciding between two almost identical computers. The two are exactly the same except for one component. System A has a proce…

5. You have a 965 mL sample of methane at 92°C and a pressure of 1.2910, tom. A.

5. You have a 965 mL sample of methane at 92°C and a pressure of 1.2910, tom. A. If you lower the temperature to -43°C without changing the volume, what pressure will the methane …

5. You have a 965 mL sample of methane at 92°C and a pressure of 1.29×10, tom e

5. You have a 965 mL sample of methane at 92°C and a pressure of 1.29×10, tom e will the methane exert? B. Using the results from part A, if you then decrease the volume to 623 mL…

5. You have just sequenced a short segment of DNA. You wish to analyze this DNA

5. You have just sequenced a short segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein. 5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTT…

5. You have just sequenced a short segment of DNA. You wish to analyze this DNA

5. You have just sequenced a short segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein. 5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTT…

5. You want to determine the acid constant for propanoic acid, C2H5COOH. 3.15 g

5. You want to determine the acid constant for propanoic acid, C2H5COOH. 3.15 g of the acid was dissolved in water and diluted in a graduated flask to 100 cm 3. The pH of the solu…

5. You want to electroplate tin on a spoon using Sn(NO3)2 (aq). a. If you apply

5. You want to electroplate tin on a spoon using Sn(NO3)2 (aq). a. If you apply a current of 0.400 A for 2.0 hours, how many grams of tin metal would be plated? b. What current wo…

5. You want to electroplate tin on a spoon using Sn(NO3)2 (aq). a. If you apply

5. You want to electroplate tin on a spoon using Sn(NO3)2 (aq). a. If you apply a current of 0.400 A for 2.0 hours, how many grams of tin metal would be plated? b. What current wo…

5. You work in a small-scale manufacturing facility that uses salicylic acid as

5. You work in a small-scale manufacturing facility that uses salicylic acid as the starting material for the synthesis of methyl salicylate, the "oil of wintergreen". Your compan…

5. You zananre directed to administer 0.7 g of kanamycin sulfate using a mixture

5. You zananre directed to administer 0.7 g of kanamycin sulfate using a mixture that contains $00 mg of 6. You are directed to administer 180 mg of cefuroxime axetil suspension. …

5. Your Favorite Gene (YFG) is cloned into pAMP and E. coli is transformed with

5. Your Favorite Gene (YFG) is cloned into pAMP and E. coli is transformed with 0.2 ug of intact pAMP/YFG recombinant according to the protocol above. Using the information below,…

5. Your Favorite Gene (YFG) is cloned into pAMP and E. coli is transformed with

5. Your Favorite Gene (YFG) is cloned into pAMP and E. coli is transformed with 0.2 ug of intact pAMP/YFG recombinant according to the protocol above. Using the information below,…

5. [16 pts] Compound Y is in 90 mL of water. The distribution coefficient for co

5. [16 pts] Compound Y is in 90 mL of water. The distribution coefficient for compound Y are as follows K eyelopentane/water 6.2 K dichloromethane-water -2.1 K diethylether!water …

5. [20 (1) The variation of chemical potential, u of a perfect gas with pressure

5. [20 (1) The variation of chemical potential, u of a perfect gas with pressure can be expressed as follows: Au RT ln Derive the below equation for Gibbs energy of mixing, when t…

5. a) What is the pH of a 0.35 M solution of benzoic acid, HC 7 H 5 O 2 ? The K

5. a) What is the pH of a 0.35 M solution of benzoic acid, HC7H5O2? The Ka for benzoic acid is 6.5 x 10-5. Show the reaction and all calculations. b) What is the percent ionizatio…

5. a. A commercial vinegar is analyzed for the percent acetic acid present. The

5. a. A commercial vinegar is analyzed for the percent acetic acid present. The data for Trial 1 is listed in the table below. Complete the table to determine the percent. (See Re…

5. a. Consider this gas phase equilibrium system: PCls(g)PCls(g) + Cl(g) AH-+87.

5. a. Consider this gas phase equilibrium system: PCls(g)PCls(g) + Cl(g) AH-+87.8 kJ/mol. Which of these statements is false? A. Increasing the system volume shifts the equilibriu…

5. a. List the various Wi-Fi standards available for building a wireless network

5. a. List the various Wi-Fi standards available for building a wireless network. Compare and contrast two of the popular standards. b. Let’s assume you are the IT manager of your…

5. ch one of the statements below is false concerning the following reaction: NH

5. ch one of the statements below is false concerning the following reaction: NH3(g) Hao(e) NH4 (aq) OH (aq) a. The double arrows indicate that ammonia, NH3, is only very slightly…

5. concepts110 Based on their activation energies and energy changes and assumin

5. concepts110 Based on their activation energies and energy changes and assumingthat all collision factors are the same, which of the followingreactions would be fastest and whic…

5. east 6. north 7. There is no force. 009 (part 1 of4) 10.0 points The strength

5. east 6. north 7. There is no force. 009 (part 1 of4) 10.0 points The strength of the Earth's magnetic field 012 (part 4 of 4) 10.0 points at the equator is approximately equal …

5. o -7 points TCCGenC 5.PRE.005. 0/3 Submissions Used My Notes For Part A of th

5. o -7 points TCCGenC 5.PRE.005. 0/3 Submissions Used My Notes For Part A of the Equilibrium experiment, you will be preparing several standard solutions for the Beer's Law plot.…

5. physics insulated container problem: A thermally insulated container consists

5. physics insulated container problem: A thermally insulated container consists of two liquid solutions separated by a semi-permeable membrane. Both solutions consist of a charge…

5. states that the total pressure of a mixture of gases is equal to the sum of t

5. states that the total pressure of a mixture of gases is equal to the sum of the partial pressures of ll gases in the mixture. 6. The gas law which states the relationship betwe…

5. the Wild Card. Rolaids is an over the counter remedy for upset stomachs that

5. the Wild Card. Rolaids is an over the counter remedy for upset stomachs that functions by reacting with stomach acid. The active ingredients are calcium carbonate (550 mg) and …

5. thermodynamics insulated container problem: A thermally insulated container c

5. thermodynamics insulated container problem: A thermally insulated container consists of two liquid solutions separated by a semi-permeable membrane. Both solutions consist of a…

5.(18ps) (a) 6pts. What is the ground state electron configuration and orbital d

5.(18ps) (a) 6pts. What is the ground state electron configuration and orbital diagram of Ta(73)? Is this paramagnetic or diamagnetic? (b) 4pts. The following is an excited state …

5.(2 points) In this experiment we have hydrated ions traversing the stationary

5.(2 points) In this experiment we have hydrated ions traversing the stationary phase. Hermione is curious why certain ions travel at different rates though the stationary phase. …