1.CRISPR-Cas9 technology is used to engineer Drosophila melanogaster in which th
ID: 90130 • Letter: 1
Question
1.CRISPR-Cas9 technology is used to engineer Drosophila melanogaster in which the Tra-1 protein is missing its RS domain. Will flies homozygous for this mutation be male or female? Explain. Grading: 1 pt for correctly indicating whether the animals will be male or female, 1 pt for describing the function of an RS domain; 2 pts for explaining why its loss will result in male or female flies (clearly indicate what would happen if the flies were genetically female, compared to if they were genetically male). 2. The partial sequence of two mRNAs are shown below that are targets of the mir-34 microRNA. The region of the mRNA that interacts with mir-34 is underlined. a. Do these mRNAs interact with the mir-34 microRNA shown in red or in blue in figure 20-12? b. Which mRNA is more likely to be degraded as a consequence of binding to the microRNA? Why? mRNA 1: 5’ GCUGCAGCGAGAAGCGGUGCCAGUAGCCGUGCCAUGUAGUCACCUA3’ mRNA 2: 5’ GACCGUUCGGGUGGCAGUGAAGGUAGCCGUGGAGCAUUAGACAGUA3’ Grading: 1 pt for indicating whether the mRNAs interact with the red or blue microRNA; 1 pt for indicating which mRNA is more likely to be degraded; 1 pt for explaining why. 3. A gene contains two domains. Which of the following configurations would make it most likely that domain 2 is successfully used in exon shuffling? Explain. Domain 1 is shown in blue, domain 2 is shown in red. Boxes represent exons, lines represent introns. Grading: 1 pt for describing what exon shuffling is and how it can cause gene evolution; 0.5 pt for correctly identifying the version of the gene that would most likely be used successfully in exon shuffling; 1.5 pt for explaining why, including how you eliminated the other options.a. b. C.
Explanation / Answer
1) In Drosophila melanogaster, Tra1 protein plays an important role in sex selection through the mechanism of sex specific alternative RNA splicing. Tra1 protein switches fru splicing from the male specific pattern to a female specific pattern through activation of female specific fru-5' splice site. Therefore, flies with mutation in Tra1 protein in RS domain will be males.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.