At least some of the RNA sequences shown below include significant regions that

Question

At least some of the RNA sequences shown below include significant regions that are self-complementary, and therefore might form secondary structures such as hairpins or stem-loops. For purposes of this question, you should identify any secondary structures that fit the following criteria: 1:) a minimum length of 5 base pair; 2.) only "Watson/Crick" pairings (i.e.- A-U or C-G), with NO mismatches or unpaired bases within the helical/paired region; and 3.) connecting "hairpin" turns or loops that consist of at least 5 unpaired bases (Note that these conditions do not always aplly to the secondary structures formed by naturally occurring RNA molecults.) Instructions: For each of the sequences given, UNDERLINE any self-complementary sequences (i.e.- indicate precisely the two stretches that could pair with each other according to the criteria listen above); if the sequence has no such regions/secondary structures, indicate "none." A.) UAUGACCGUACAGCGUACGGUUCGUG B.) ACAGAUCUGACGGAUAGCGUCUAGAUCUUA C.) CUCUAAGAAGGCUACUCCGGUCUUAGAGCUAAUAGAG D.) ACAGAUCUGACGGAUAGUGUCUAGA

Explanation / Answer

Answer

A. UAUGACCGUACAGCGUACGGUUCGUG- None because it is not following the above criteria of RNA hairpin.

B. ACAGAUCUGACGGAUAGCGUCUAGAUCUUA- One hairpin structure ( complementry sequence is bold and underline).

C. CUCUAAGAAGGCUACUCCGGUCUUAGAGCUAAUAGAG- one hairpin structure ( complementary sequence is bold and underlined)

D. CAGAUCUGACGGAUAGUGUCUAGA- None since it is not following the above criteria of Hairpin.

Related Questions

Navigate

• Browse (All)
• Browse A
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.