Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

At least some of the RNA sequences shown below include significant regions that

ID: 84209 • Letter: A

Question

At least some of the RNA sequences shown below include significant regions that are self-complementary, and therefore might form secondary structures such as hairpins or stem-loops. For purposes of this question, you should identify any secondary structures that fit the following criteria: 1:) a minimum length of 5 base pair; 2.) only "Watson/Crick" pairings (i.e.- A-U or C-G), with NO mismatches or unpaired bases within the helical/paired region; and 3.) connecting "hairpin" turns or loops that consist of at least 3 unpaired bases (Note that these conditions do not always aplly to the secondary structures formed by naturally occurring RNA molecults.) Instructions: For each of the sequences given, UNDERLINE any self-complementary sequences (i.e.- indicate precisely the two stretches that could pair with each other according to the criteria listen above); if the sequence has no such regions/secondary structures, indicate "none." A.) UAUGACCGUACAGCGUACGGUUCGUG B.) ACAGAUCUGACGGAUAGCGUCUAGAUCUUA C.) CUCUAAGAAGGCUACUCCGGUCUUAGAGCUAAUAGAG D.) ACAGAUCUGACGGAUAGUGUCUAGA

Explanation / Answer

Answer:

Based on the sequences given: *sites marked in bold can self-anneal and are self-complementary - atleast 3 unpaired bases.

A) UAUGACCGUACAGCGUACGGUUCGUG (*ACCG can self anneal to CGGU - potential hairpin formation)

B) ACAGAUCUGACGGAUAGCGUCUAGAUCUUA

ACAGAUCUGACGGAUAGCGUCUAGAUCUUA

ACAGAUCUGACGGAUAGCGUCUAGAUCUUA

ACAGA-UCUGACGGAUAGCGUCUAGAUCUUA

(*AGA and UCU are self-complementary sequences, GACG and CGUC are self-complementary, CAGA and UCUG are self-complementary - Potential hairpin formation sites)

C) CUCUAAGAAGGCUACUCCGGUCUUAGAGCUAAUAGAG

CUCUAAGAAGGCUACUCCGGUCUUAGAGCUAAUAGAG

(*AAGA and UCUU are self-complementary sequences, AAG and CUU are self complementary sequences - Potential hairpin formation sites)

D) ACAGAUCUGACGGAUAGUGUCUAGA

ACAGAUCUGACGGAUAGUGUCUAGA

ACAGA-UCUGACGGAUAGUGUCUAGA

(* AGA and UCU, ACA and UGU, CAGA and UCUG are all self-complementary potential hairpin loop sites)

Additional Information:

A)

For self-dimerization (with minimum 5 unpaired bases, the sites marked in bold below are potential self-annealing sites)

B) ACAGAUCUGACGGAUAGCGUCUAGAUCUUA - None (with minimum 5 unpaired bases)

C) CUCUAAGAAGGCUACUCCGGUCUUAGAGCUAAUAGAG - None (with minimum 5 unpaired bases)

D) ACAGAUCUGACGGAUAGUGUCUAGA- None (with minimum 5 unpaired bases)

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote