Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Section: Mon(pm) I ues(am) Tues(pm) wed(pm) Thur(am) Thur(pm) Thur(eve) Fri(pm)

ID: 73589 • Letter: S

Question

Section: Mon(pm) I ues(am) Tues(pm) wed(pm) Thur(am) Thur(pm) Thur(eve) Fri(pm) Instructor: Mullen Cyr Smith Dore V_ V RIO 101 Lab Assignment #10b - 56 Points Consider the two samples of DNA shown below: DNA Sample #1 5'"TCCAGTGATCTCG|AATTCGCTAGTAACGTTCGAT 3'-AGGTCACTAGAGCTTAA(GCGATCATTGCAAGCTA DNA Sample #2 5'-tcatcg|aattcctggaatcagcag1aattcgcata 3'-agtagcttaa|ggaccttagtcgtcttaa|gcgtat If both samples are treated with the restriction enzyme EcoRI [recognition sequence G'AATTC] then indicate the number of fragments and the size of each fragment from each sample of DNA.

Explanation / Answer

the restriction enzyme cuts at that specific sequence,GAATTC then just find out how many times that sequence occurs in each of the dna strands (it appears once in sample 1 and once in sample 2), so there will be one cut in each of the strands, therefore each strand will be cut into 2 fragments.
- The restriction enzyme is going to cut between the second adenine and the first thymine in recognition site, so just count the base pairs in each fragment

sample 1 #’ 12 and 16 bp

sample 2 # 5, 12 and 5 bp

size of fragments ---------à 16, 12 and 5

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote