Your boss gives you a PCR to perform. She wants you to amplify part of the targe
ID: 72308 • Letter: Y
Question
Your boss gives you a PCR to perform. She wants you to amplify part of the target sequence given below in bold and underlined (notice you are given the sequence of only one strand of DNA). Design primers that will amplify the target sequence. The amplified product should include the sequence in bold. You must indicate the region of the sequence below where your primers anneal (circle these nucleotides and mark as “forward” and “reverse” to indicate site of annealing – zero credit for this problem if these sites are not indicated). Fill out the table below and refer to questions 2 & 3 when considering melting temperature and G/C content. Remember you need both a forward (5’) and a reverse (3’) primer. Be sure to indicate the 5’ and 3’ ends of the primers in your responses below.
5’GAGATTCAAGTTCTTCCCTTTGAAAGGCATGATGTTGACGCGGATGAAGATTTTATTGGTGATGCT AGTTGTACATTAACATCAATTTTATCAAACCAGGTCAAACTGTTTGTTTACAATTATTAACTAAAAGT GGTAAACATGCAGGGTCAATGACAGTTATTGCAGAAGAAATTAATACTTTACAAACAATTAAATTCAA TCTTATTGGTAAGAAATTTGAAAGATTTATTTGGAGCTGGTTGTGATCCATATCTTATCATTTCAAGA AAGTACCATCAACCAATACATTTGTT-3’
5’ Primer Sequence (i.e. Forward Primer):
(write answer in 5’ 3’ direction)
3’ Primer Sequence (i.e. Reverse Primer):
(write answer in 5’ 3’ direction)
Paramter Response
5’ Primer Sequence (i.e. Forward Primer):
(write answer in 5’ 3’ direction)
? Melting Temp (Tm) for Forward Primer: ? GC Content for Forward Primer: ?3’ Primer Sequence (i.e. Reverse Primer):
(write answer in 5’ 3’ direction)
? Melting Temp (Tm) for Reverse Primer: ? GC Content for Reverse Primer: ?Explanation / Answer
* The sequence of forward primer is 5' ATCACCAATAAAATGTTC 3'
* The melting temperautre of forward primer is approximately 43o C
* The GC content of forward primer is 28%
* The sequence of reverse primer is 5' TATGGATCACAACCAGCT 3'
* The melting temperature of reverse primer is approximately 50o C
* The GC content of reverse primer is 44%
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.