A geneticist is interested in determining the locations of methylated cytosines

Question

A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the presence of methylated cytosines.

Sequence without treatment:

—AATTGCCCGATCGATTAAGCCA—

Sequence with treatment:

—AATTGTTTGATCGATTAAGCTA—

Sequence without treatment:

—AATTGCCCGATCGATTAAGCCA—

Sequence with treatment:

—AATTGTTTGATCGATTAAGCTA—

Explanation / Answer

Cm = methylcytosine

Bisulfite Conversion Converts Cytosines to Uracils

Treatment of DNA with bisulfite converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected.

Sequence without treatment:

—AATTGCCCGATCGATTAAGCCA—

Sequence with treatment:

—AATTGTTTGATCGATTAAGCTA—

Sequence Before PCR with polymerase

After PCR                    —AATTGTTTGATCGATTAAGCTA—

Before PCR                    —AATTGUUUGATCGATTAAGCUA—

Before sulfite conversion U is C

Before bisulfate treatment                    —AATTGCCCGATCmGATTAAGCmCA—

original sequence of the DNA fragment and indicate the presence of methylated cytosines.

—AATTGCCCGATCmGATTAAGCmCA—

Sequence without treatment:

—AATTGCCCGATCGATTAAGCCA—

Sequence with treatment:

—AATTGTTTGATCGATTAAGCTA—

Related Questions

Navigate

• Browse (All)
• Browse A
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.