Molecular Biology help ASAP! Please answer all 4 conceptual questions! Conceptua

Question

Molecular Biology help ASAP! Please answer all 4 conceptual questions! Conceptual Questions Discuss the similarities and differences between RAPD analysis and RFLP analysis Your graduate advisor gave you a sample of genomic DNA from C elegans. He wants you to amplify the gene for transposase. The following is a diagram of the gene. Using the sequence information given, design two 18 nucleotide PCR primers to amplify the gene. Both sequences are shown from the non-coding strand of DNA. Transposase gene 5CACAATTGGCCCGTATCGAATAT GGATATCTTTTTGGCCAGCACTG3 3 Using your knowledge of PCR methods to induce mutations, design PCR primers that will inactivate the above transposon by mutating the key nucleotides (as shown in bold) in the inverted repeats 4 Design degenerate primers that are 9 nucleotides in length that will amplify the gene corresponding to the following protein sequence listed in single-letter amino acid abbreviations: mikdtsvepe ganfiaeffg fvfeldpdtd asprplaphl eirvnvdtli dlalrespra algpsgpvat ftdkvearml rfwpktrrrr sttpggqrgl fda S. You have just started as a genetic counselor, and there is a couple that would like to have children, but the man has a brother with Friedreich's Ataxia. The woman has a distant relative that had the same disease. This is an autosomal recessive genetic disorder that is cause by trinucleotide (GAA) expansion within the first intron of the FXN gene, which encodes the protein frataxin. This intron is 500 base pairs long without the GAA repeats The expansion of this repeat interrupts the splicing of the intron, and therefore, inactivates frataxin. A normal person has between 5 and 35 GAA repeats, a person with premutation has between 34 and 65 repeats, and an affected individual has between 66 and 1700 uninterrupted GAA repeats It is possible to be a carrier for the disease without any symptoms because the normal allele is dominant. Explain how you would design a PCR experiment to determine if either couple is a carrier. What is the chance of having a child with Friedreich's Ataxia if both parents are carriers?

Explanation / Answer

1A) The diference between RAPD(Random Amplified Polymorphic DNA) and RFLP(Restriction Fragment Lenght Polymorphism) are

(a) In RAPD small quantity of DNA sample is required for analysis(10-50 ng) where as in RFLP large quantity of DNA sample is required for the analysis(2-10 micrograms) is required.

(b) Less steps are involved in RAPD and more steps are involved in RFLP. Hence RAPD is about 5 times faster than the RFLP.

(c) Allelic variants cannot detected by RAPD analysis where as allelic variants can be detected by RFLP analysis.

(d) In RADP analysis 1-10 loci are detected, In RFLP analysis 1-3 loci are detected.

  

Related Questions

Navigate

• Browse (All)
• Browse M
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.