a) Underline the promoter region by a dotted line. b) Deduce the nucleotide sequ

Question

a) Underline the promoter region by a dotted line.

b) Deduce the nucleotide sequence of mRNA for this gene.

c) Underscore the leader sequence in mRNA and box the initiation codon.

d) Show 5

8) The following DNA strand is a template strand of a prokaryotic gene. Asterisk indicates the transcription initiation site. a) Underline the promoter region by a dotted line. b) Deduce the nucleotide sequence of mRNA for this gene. c) Underscore the leader sequence in mRNA and box the initiation codon. d) Show 5' and 3' ends of the template strand and mRNA. GGCACCGTCGCTATTACGAAGTCGCTGACGGATC TACCCCGGATTT

Explanation / Answer

                  -10 * +10

            5`--GGCACCGTCGCTATTACGAAGTCGCTGACGGATC TACCCCGGATTT --3`

mRNA: 3`- CCGUGGCAGCGAUAAUGCUUCAGCGACUGCCUAGAUGGGGCCUAAA --5`

The promoter sequence : at -10 upstream TATTAC

The leadersequence in mRNA at the initiation codon: initiation starts at 3` - CGA-5`.

Related Questions

Navigate

• Browse (All)
• Browse A
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.