You want to amplify the sequence below using PCR. The sequence shown in red repr
ID: 321742 • Letter: Y
Question
You want to amplify the sequence below using PCR. The sequence shown in red represents the sequence that MUST be included in the amplified product, though any flanking sequence is fine. You have designed the forward primer given below. Which of the following reverse primers would be the best choice for amplifying this DNA? Include the reasons for your choice, as well as your reasons for eliminating the other choices. Forward primer: 5' GTGAGCTACCCAAGTATGCC 3' Sequence (note that only one strand of the sequence is given): 5'GTCAGCTACCCAAGTATGCCCTCCAAGAGCACACATCTGA7CGTCGGATTCTACTGTACTCCCCGAAA ACCAACAAAAAACACAAGTTTTTGGACACTTG7GGATCCACACAACCATCACGAGAATGAATATTGTAA CAGATCTCGGAGACGACACAAAATT'rTGGAAAATTTGGAAGAAGAGAATATTCTAATGAGCTACTCATTA ACGACTTCAACAACCGCTGCCACCGAAGCTCTCGCAACGGACACTCAGCATAGGACCCTTAAGCAGCA 3' 5' 7AATGAGTAGCTCATTAGAA 3' 5' CTATCCTCACTCTCCGTTCC 3' 5' GGAACGGACACTCAGCATAG 3' d. 5' GTCTGCATCCACAAGTGTCC 3' Grading: I pt for correctly indicating the best reverse primer to amplify the sequence; I pt for your explanation of how the primer was chosen, including consideration of location. orientation, melting temperature. GC content and 3' ends. I pt for your explanation of why the other primers were not chosen. including whether location. orientation, melting temperature, GC content and/or 3' ends were used to eliminate each choice.Explanation / Answer
Answer is A
In the PCR amplification reaction, there are two primers forward and reverse primer, because the two strands leading and lagging strand amplifys at a time with a primer each,
The leading strand from 3' to 5' is forward primer.
The lagging strand 5' to 3' is reverse primer...
In the present qs given forward primer and the strand is lagging strand,(5'-3') so write the complementary bases from end of the red shaded amplified part you will get the reverse primer...
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.