You use the primer 5\' GCCTCGAATCGGGTACC 3\' to sequence part of a human DNA ins

Question

You use the primer 5' GCCTCGAATCGGGTACC 3' to sequence part of a human DNA insert of a recombinant DNA molecule made with a plasmid vector. The result of the automated Sanger sequencing analysis is shown below. (Note that: A = green; C = purple; G = black; T = red.) a. Write the sequence of all the nucleotides of human DNA that you can determine Indicate the 5' to 3' orientation of this sequence b. Is the sequence from (a) part of the new DNA strand that was synthesized in the sequencing reaction or part of the template strand used in the sequencing reaction? Why? c. If you were performing this experiment, how would you know how to design the appropriate primer for the sequencing reaction? d. Draw the recombinant DNA molecule that was sequenced. Indicate the human and vector sequences, the position and orientation of the primer, and the position and orientation of new DNA synthesized during the sequencing reaction. (See Fig. 9.7.) e. Give the full sequence of the smallest DNA molecule synthesized in the sequencing reaction that contains a dideoxyG (ddG). Indicate the 5'-to-3 orientation of the molecule and the location of the ddG

Explanation / Answer

a) 5'TTTGCTTTGTGAGCGGATAACAA3'

b) In Sanger Sequencing, Chain termination method is used, which employs the template of our interest to hybridise with the Primer specific to it and then ddNTPs are introduced to mark the synthesis pattern and termination.

Thus the sequence in the Chromatogram is the new DNA Synthesised from our Template.

c) Primer design can be done accurately when we know the sequence of our gene of interest or any similar genes of related organisms. In case our gene of interest is unknown and we should predict the sequence for the same, we can use common universal primers and sequence.

d ) More information needed.

e) 5'TTTG3'

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.