Define zero order Markov model for sequence2_A2, which represents portion of non

Question

Define zero order Markov model for sequence2_A2, which represents portion of non-coding sequence of Mycobacterium tuberculosis

sequence2_A2: ggacccgcatgtcgcccgggcgttgacgctggcggcgcggtttcagtcggccctagacgggacgctcaatcagatgaacaacggatccttccgcgccaccgacgaagccgagaccgtcgaagtgacgatcaatgggcaccagtggctcaccggcctgcgcatcgaagatggtttgctgaagaagctgggtgccgaggcggtggctcagcgggtcaacgaggcgctgcacaatgcgcaggccgcggcgtccgcgtataacgacgcggcgggcgagcagctgaccgctgcgttatcggccatgtcccgcgcgatgaacgaaggaatggcctaagcccattgttgcggtggtagcgactacgcaccgaatgagcgccgcaatgcggtcattcagcgcgcccgacacggcgtgagtacgcattgtcaatgttttgacatggatcggccgggttcggagggcgccatagtcctggtcgccaatattgccgcagctagctggtcttaggttcggttacgctggttaattatgacgtccgttacca

Explanation / Answer

Zero order Markov model: P(i) where i = {A,T,G,C}

Total nucleotides = 539

Number of A = 104

Number of T = 100

Number of G = 180

Number of C = 155

P(A) = Number of A / Total nucleotides = 104/539

P(T) = Number of A / Total nucleotides = 100/539

P(G) = Number of A / Total nucleotides = 180/539

P(C) = Number of A / Total nucleotides = 155/539

Related Questions

Navigate

• Browse (All)
• Browse D
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.