Please answer all parts and make sure to explain how you can tell which strand i

Question

Please answer all parts and make sure to explain how you can tell which strand is the newly synthesized one. Thank you

6) (from a previous exam) A small sequence of a replicating chromosome is shown below. .GCTAATAAAACTTCGCCATGCUCUCCCUUGGAAUUCCGGCAUUCCATGGAATTTCCTCCCATTCTTTTATACTTA 5 CGATTATTTTGAAGCGGTACGAGAGGGAACCTTAAGGCCGTAACCTACCTTAAAGGAGGGTAAGAAAATATGAAT A. Is the top or bottom strand the newly synthesized strand? Circle one: top strand/bottom strand B. If this is a eukaryotic chromosome, indicate with an arrow the end or ends where there may be chromosome shortening for this round of replication. C. Circle ONE possible start of translation that would appear in an RNA for a gene X. D. For gene X, in which direction does transcription occur? Towards the (circle one) right or left

Explanation / Answer

There are two strands that is 5' and 3' which indicated in one end and is newly synthesised one

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.