Q. Identify and explain how the system of a single cell is supposed to function
ID: 270356 • Letter: Q
Question
Q. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the item listed below. This means explaining how all aspects of the cell (inside and outside) may be impacted by this problem.
-Make sure to fully explain the item listed in the cellular dysfunction as well as all other related items in the system of a cell.
1. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)
1a. Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA
1b. Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA
Explanation / Answer
Every single cell, in a given appropriate environment has to perform functions of Transportation, Reproduction and Metabolism. This is irrespective of the cell being a unicellular organism or a cell that is a part of a tissue, with an assigned function.
Transportation involves transfer of ions and other molecules in and out of the cell. Reproduction is where the genetic material is transmitted from one generation to another, for new cells to form, either by mitosis or meiosis. Metabolism refers to all the chemical reaction that takes place inside the cell pertaining to breaking or making of a biomolecule and also deriving or trapping energy in the process.
An inherited autosomal recessive mutation of hydrolytic enzyme when encountered, the cell undergoes tremendous changes. Firstly, hydrolytic enzymes or hydrolases are enzymes that are required to bring about catalytic reactions to breakdown larger molecules to smaller, and is a large group of enzymes including proteases, lipases, amylases, nucleases, etc. If mutation (deletion, insertion as in this case) occurs is any of these enzymes, it will result in reduced or eliminted catalytic activity of the respective enzyme. The result would be accumulation of their substrate. The prolonged accumulation of molecules may then lead to a diseased state, as is seen in lysosomal storage disease.
Since it is an autosomal recessive mutation, unless it is present on both alleles, the mutation will not be evident. When present, it will mostly change the phenotypic appearance of the cell depending of which function is impaired. In the given case, increases GC content (higher than normal - increased by 6%) may also reduce longevity of the cell.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.