AUGGGCUUCCAGGACGGUCGG This is the sequence of a piece of mRNA. Write the amino a
ID: 268187 • Letter: A
Question
AUGGGCUUCCAGGACGGUCGG This is the sequence of a piece of mRNA. Write the amino acid sequence of the protein that would be formed by translating this piece of mRNA Use the three letter abbreviation for the amino acids and do not capitalize any of the letters. Using the sequence above, describe what would happen to the protein product of this piece of mRNA and say what kind of mutation has occurred in the following 2 scenarios: What would happened to the protein produced if the underlined C were changed to a U: What type of mutation is this? (do not capitalize What would happened to the protein produced if the underlined C were deleted: (do not capitalize What type of mutation is this? (do not capitalize NextExplanation / Answer
3-letter abbreviation protein code:
MGFQDGR = MetGlyPheGlnAspGlyArg
If underlined C changed to U, then:
Protein = MGFQDGR = MetGlyPheGlnAspGlyArg
This is Silent Mutation
If underlined C were deleted, then:
Protein = MGFRTV = MetGlyPheArgThrVal
This is Frame-shift mutation
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.