6- In most models, Watson-Crick hydrogen bonding drives integration of nucleotid

Question

6- In most models, Watson-Crick hydrogen bonding drives integration of nucleotides into DNA strands and maintains the complementarity of base pairs. Studies with nonpolar analogues of thymine and adenine have shown that replication is still efficient in the absence of hydrogen bonds. This demonstrates that the replication of base pairs might also be influenced by steric exclusions.
a. Design a base pair that would allow you to test this idea. (hint: the size of a pyrene approaches that of a complete thymine-adenine base pair)
b. Suggest how this base pair can be useful in identifying DNA damage such as abasic lesions.

Explanation / Answer

Yes, hydrogen bonds are the one which drives the incorporation of nucleotide bases into DNA strands, which maintains the complementarity of base pairs.

Sometimes Watson-Crick (W-C) hydrogen bonding between the bases is not required for the synthesis of DNA because, DNA polymerase distinguish the correct and incorrect bases by using geometric difficulties imposed by the tight fit of active site with primary base pair.

a. Base pair that would allow you to test this idea

Running start substrate

5' - TAATACGACTCACTATAG

3' - ATTATGCTGAGTGATATCCCTCTNGTCA

Standing start substrate

5' - TAATACGACTCACTATAGGGAGA

3' - ATTATGCTGAGTGATATCCCTCTNGTCA

b. Thymine-adenine have mutagenic effect hence they help in identifying DNA damage such as abasic lesions.

Related Questions

Navigate

• Browse (All)
• Browse 6
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.