Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Name C# BIL 150 Workshop 6 Part 1: Gene Expression Second letter UGU Cys c UGC U

ID: 252671 • Letter: N

Question

Name C# BIL 150 Workshop 6 Part 1: Gene Expression Second letter UGU Cys c UGC UAU UAC UAA Stop UGA Stop A UAG Stop UGG Trp G CAU CAC CAA CAG AAU Phe ucc Ser Tyr UUC UUA UUG CUU Ul UCA CCU CGU CUA Leu CCC CUG CCA Pro CCG ACU ACC Thr AAA Lys AGG ACA CGC Gin CGG AGU Arg AUU A AUA Asn AGC AUC lle AUG Met ACG GUU GUC ValGCA GUG AAG GCU GCA tAla GAC Asp GGU GCC Ala GAA 1Glu GGG G GUA GCG GAG GluGGAGly C . What DNA sequence is complementary to 3' -TACGTATGACTCTAAGCAACT-5'? 2. If 3'-TACGTATGACTCTAAGCAACT-5'acts as the template for transcription, what would the sequence of the mRNA be? 3. What would be the amino acid sequence if the mRNA is translated? 4. Where in the cell does protein synthesis occur? 5. Exposing DNA to UV radiation induces mutations in them. The DNA sequence in #2 was exposed to UV for 2 minutes. Post UV exposure the DNA was sequenced to detect induced mutations. If the DNA sequence obtained was TACGTGTGACTTTAAGCAACT (nucleotides in red indicating changes due to mutation), what would be the resulting polypeptide sequence? 6. The codon GUU codes for the amino acid valine (V). If a mutation replaces the last nucleotide in this codon with a different nucleotide, what are the chances that a different a mino acid will be encoded?

Explanation / Answer

1.. complementary DNA sequence

5’- ATG CAT ACT GAG ATT CGT TGA- 3’

2..if the given sequence act as a template than the mRNA for transcription is,

5’- AUG CAU ACU GAG AUU CGU UGA- 3’

3.. The amino acid sequence is

Met- His- Thr- Glu- Ile- Arg- stop codon

Met- methionine, Thr- thrionine, Glu- glutamine, Ile- isolucine, Arg- argentine

4.. after the DNA synthesis occurred in the cell nucleus the protein synthesis (translation) occurred in the ribosome of cell which is situated into the cytoplasm of cell. Synthesized DNA created mRNA which comes out from the nucleus and reached to ribosome for protein synthesis.

(as per the chegg policy I can answer 4 question )