1. Why does Synechocystis not require electroporation or chemical pretreatment p
ID: 23527 • Letter: 1
Question
1. Why does Synechocystis not require electroporation or chemical pretreatment prior to transformation?2. What specific genetic manipulation does Synechocystis readily allow that E. coli does not?
3. For transformation of Synechocystis, why do you first plate your transformant mixture on a filter on a BG - 11 plate with glucose, and the next day the TA transfers the filter with cells to a plate that contains kanamycin (rather than plating directly on kanamycin)?
4. What is the product of the psbC gene? What is its function?
5. In the PCR reaction, what is the role of each of the PCR reagents: primers, dNTPs, Mg2+, and Taq polymerase?
6. What are the considerations in determining the number of cycles needed for the PCR reaction?
Explanation / Answer
2)E. coli is not the sole bacterium that is amenable to molecular biology. There are many such bacteria. In this lab, one of these, the cyanobacterium Synechocystis sp. PCC6803 is introduced. This cyanobacterium has several advantages that make it a very useful organism for gene manipulations. The two main advantages are: 1. Natural transformability. In contrast to E. coli and most other bacteria, it spontaneously takes up foreign DNA that is present in the growth medium, and can integrate it into its genome through a double homologous recombination event. Double homologous recombination is appropriate to introduce gene interruptions or deletions using a construct with two regions of sequence identity with the cyanobacterial genome. 2. The ability to grow in many different conditions. It can grow photoautotrophically utilizing its photosynthetic system to produce sugars from CO2 and water, using light for energy. It also can grow photoheterotrophically utilizing a reduced carbon source in the growth medium. This characteristic helps Synechocystis survive under different growth conditions, and cope with a mutation in its photosynthetic system. As most prokaryotes, Synechocystis has a double-stranded circular genome. However, in contrast to many other prokaryotes, it carries multiple (6-12) copies of the genome in a single cell. As upon transformation only a single genome copy in the cell may be altered, wild-type and mutant genomes are slowly sorted out (segregated) upon repeated cell divisions. A Synechocystis mutant means that all genome copies carry the same mutation, and that the wild-type genome copies are absent. Segregation of mutants is achieved through a steep increase in the antibiotic concentration in the growth medium. Cells that carry the mutation in every copy of the genome are at a selective advantage to cope with high concentrations of the antibiotic.Transformation of Synechocystis with pKCP43 Work in sterile conditions! Many prokaryotes grow faster than Synechocystis, so contamination is a real problem, particularly if glucose is present! 1. (prepared by the TA) Grow Synechocystis on BG - 11+ glucose medium to OD730 = 0.5. (OD730 is the optical density at 730 nm, which is in the infrared region of the spectrum where very little absorbs. The optical density is not absorption, but rather scattering of light by cells. This is a good measure of the cell density.) 2. (prepared by the TA) Sterilely transfer 1.5 ml of culture to a sterile microcentrifuge tube. 3. Spin cells at 7000 rpm for 2 minutes in a balanced microcentrifuge. 4. Remove the supernatant by pipetting. 5. Add 200 µl of fresh BG - 11 medium to the cells and resuspend cells by pipetting in and out. 6. Add 2 µl of the pKCP43 plasmid and shake the tube several times. 7. Incubate at room temperature for 30 minutes. 8. Place a sterile filter on top of an agar plate that contains BG - 11 + 5 mM glucose. Plate the cell suspension on the filter, spread it, and let it dry. The plate will be incubated in the light at 30 °C. The TA will transfer the filter the next day to a BG - 11/glucose plate that contains 5 µg/ml kanamycin. 9. In week 4, you will transfer a single colony from this plate to a fresh agar plate that contains a higher concentration of kanamycin. Polymerase Chain Reaction (PCR) Polymerase chain reaction (PCR) enables the amplification of any DNA sequence (producing millions or even billions of copies) in just a few hours. An important feature of PCR is that the DNA segment chosen to be amplified does not need to be separated from the rest of the genomic DNA prior to initiating the amplification procedure. However, once amplified, the segment can readily be separated from the bulk of DNA (which is not amplified) by gel electrophoresis. Amplification of part of the wild-type psbC Numbering of the psbC locus starts at 1 and terminates at 1418. In the PCR reaction today you will amplify the sequence between 662 and 2819: this means that you will amplify the 3' end of the gene and the adjacent (flanking) region. PCR requires buffer, primers, and nucleotides (dNTPs). Keep dNTP on ice at all times. After adding dNTP to your sample, place samples on ice. Wear gloves when handling the reagents to eliminate the possibility of contaminating your samples by proteases, DNase, or an alternate template. Materials: PCR 0.2 ml PCR tubes P20, P200, and pipet tips Disposable gloves DNA thermal cycler 8 pmol/µl CP1 forward primer (662) 5' GTTGGATCATCAGTGTCAACAACATGG 3' 8 pmol/µl CP2 reverse primer (2819) 5' GCTACCTAAACAGAGTATCTAACG 3' 10x PCR Buffer Taq Polymerase ddH2O Synechocystis genomic DNA 1 mM dNTPs Ice Inoculating loop BG - 11+glucose+kanamycin (20 µg/ml) agar plates Tape Method: PCR Amplification of Part of the Wild-Type psbC Gene 1. Add the reagents in the order listed below: Reagent Volume, µl 1. ddH2O 27.5 2. PCR Buffer 5 3. CP1 2.5 4. CP2 2.5 5. dNTP 10 6. Genomic DNA 2 Mix 7. Taq Polymerase 0.5 Total volume 50 2. Mix the sample by pipetting the full volume in and out. 3. Place your sample in the Thermal Cycler and set to the following parameters: 1. 94 °C for 3 minutes 2. 94 °C for 1 minute 3. 58 °C for 1 minute 4. 72 °C for 1 minute Repeat steps 2-4 30 cycles 5. 4 °C soak cycle 4. The TA will remove samples from the PCR machine, and put them at -20°C. Prelab Questions 1. Discuss why Synechocystis does not require electroporation or chemical pretreatment prior to transformation. 2. What specific genetic manipulation does Synechocystis readily allow that E. coli does not? 3. Discuss the procedure for isolation of Synechocystis transformants. Why do you first plate your transformant mixture on a filter on a BG - 11 plate with glucose, and the next day the TA transfers the filter with cells to a plate that contains kanamycin? Would it not be much more convenient if you directly plated your cells on a kanamycin-containing plate? 4. Discuss the procedure for segregation of Synechocystis mutants. 5. What is the product of the psbC gene? What is its function? 6. Compare the use of E. coli as a plasmid DNA copy machine versus the use of PCR. 7. What is the role of each of the PCR reagents, i.e., primers, dNTP, Mg2+, and Taq polymerase? 8. What are the considerations in determining the number of cycles needed for the PCR reaction? Weekly Report Update 1. Discuss the use of the pKCP43 plasmid for mutation of the psbC gene. 2. Discuss the use of PCR for amplification of part of psbC gene. Experiment II Week 3 Record your observations regarding the Synechocystis transformant plates. Experiment II Week 4 Segregation of Mutant Synechocystis Transformants by Transferring to Higher Antibiotic Concentration Work in sterile conditions 1. Label the bottom of a BG - 11+ glucose+ kanamycin (20 µg/ml) plate. 2. Sterilize the inoculation loop by flaming it in the burner flame until it glows red, and then passing the entire wire through the flame. 3. Cool the loop by dipping it into the agar of the fresh plate (lift the lid of this plate not more than necessary, and do not touch the plate or the lid with the loop or the handle of the inoculation loop); do not set the inoculation loop on the bench. Close the plate. 4. Remove the lid from the culture plate prepared in lab 3 and place it right-side up next to the culture plate. 5. Using the loop tip, scrape up a single colony being careful not to gouge the filter or agar. Close the plate. 6. Open the BG - 11+ glucose+ kanamycin (20 µg/ml) plate just enough to streak the top surface of the agar by gliding the loop back and forth several times to cover a quarter of the plate (Figure 3, hand out). 7. Replace the lid and sterilize the loop again by repeating steps 2-3. 8. Carefully open the freshly streaked plate, and starting from the edge of the first streak, make a zigzag streak across the second quarter of the plate. 9. Sterilize and cool the loop again and make a second zigzag starting from the edge of the first zigzag covering the third plate quarter. 10. Sterilize and cool the loop again and make a third zigzag starting from the edge of the second zigzag covering the forth plate quarter. 11. Put on the lid and incubate the plate at 30°C in the light. Gel electrophoresis of PCR product Materials PCR samples from previous lab period Agarose gel with ethidium bromide (prepared by TA) 6X Loading dye Electrophoresis box, tray and comb 1 kb DNA marker TAE buffer Microcentrifuge 1.5 ml Microcentrifuge tubes P20, P200, and tips 1 mg/ml ethidium bromide solution Gel Electrophoresis on PCR Product NOTE: You will also be running samples from Experiment I at the same time. They can be run on the same or different gels. 1. Place 2 µl of loading dye on a small piece of parafilm and add 10 µl of the PCR product. Mix by pipetting the full volume of sample (12 µl) in and out. 2. Load the PCR sample in a well, and load 4 µl of the 1 kb DNA ladder in a separate well next to your sample(s). 3. Run the gel for 40-50 minutes at 70 volts. 4. Carefully remove your gel from the gel electrophoresis box into a container for safe transport of ethidium bromide-containing material to the AlphaImager. 5. View with a UV source (AlphaImager) and photograph your gel. Prelab Questions 1. What size fragment do you expect the PCR product to be? 2. Why is it necessary to analyze the PCR product by gel electrophoresis? Weekly Report Update 1. Present the result of gel electrophoresis. Include your gel photograph. Experiment II Week 5 Purification of the PCR Product You will use a commercial kit, QIAquick PCR Purification Kit (http://www1.qiagen.com/Products/DnaCleanup/GelPcrSiCleanupSystems/QIAquickPCRPurificationKit.aspx?rp=1000254&rpg=0). You can obtain the product protocol as a pdf file “QIAquick_Spin_Handbook.pdf” on the Blackboard site. The process works via binding of DNA to silica at high ionic strength, and release at low ionic strength (Fig. 3). Addition of chaotropic salt drives binding of DNA via the negatively charged phosphate groups, via salt bridge.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.