1. Which of the following events signals the termination of translation in eukar

Question

1. Which of the following events signals the termination of translation in eukaryotes? A. The ribosome reaches the end of the mRNA. B. The ribosome reaches the poly A tail. C. The ribosome reaches a stop codon. D. The ribosome runs out of charged tRNAs. E. The polypeptide chain folds into a protein.

2. What is the underlying reason that a lambda phage would need to switch from the lysogenic state to the lytic state? A. To have its genome replicated B. To kill its host cell C. To make more of the Cro protein D. To be more efficient in its use of resources E. To escape an endangered host cell

3. What is an insulator sequence for? A. it binds to transcriptional activators to increase levels of transcription B. it is highly methylated to increase levels of transcription C. it acts to keep the regulatory elements of one gene from affecting the expression of a second gene. D. it binds to the AraC protein to help increase levels of transcription E. none of the above

4. Which of the following could be ligated together? Refer to the following BamHI G*GATCC (* is site that is cut) EcoRI G*AATTC EcoRV GAT*ATC Sau3A *GATC HindIII A*AGCTT PvuII CAG*CTG NotI GC*GGCCGC A. Bacterial EcoRI and human BamHI fragments B. Bacterial PvuII and human EcoRV fragments C. Bacterial BamHI and human Sau3A fragments D. More than one of the above E. None of the above For questions 5-15, choose the most likely outcome after infection with a mutant lambda phage of the given genotype from the list given: A. lytic possible, lysogenic possible B. lytic possible, lysogenic impossible C. lytic impossible, lysogenic possible D. lytic impossible, lysogenic impossible E. cannot be determined

5. The Cro protein is unable to bind DNA

6. The N protein does not function

7. The cII protein does not function

8. The Q protein does not function

9. PRM is unable to bind RNA polymerase

10. The cI protein does not function

11. The lambda repressor is mutated such that is binds operator O R3 more tightly than it binds O R2 or O R1.

12. The structural genes that encode for viral coat proteins (both head and tail) are deleted.

13. The PRM is removed from the genome and re-cloned in “backwards”.

14. The virus is altered such that the cI protein is driven from a constitutive promoter.

15. The virus is altered such that the N protein is driven from a constitutive promoter.

For the questions 16-25 answer the following: A. When inducer is absent Beta-gal activity is absent. When inducer is present Beta-gal activity is present B. When inducer is absent Beta-gal activity is absent. When inducer is present Beta-gal activity is absent C. When inducer is absent Beta-gal activity is present. When inducer is present Beta-gal activity is present D. When inducer is absent Beta-gal activity is present. When inducer is present Beta-gal activity is absent For questions + indicates a functional DNA element or gene, - is a loss of function mutation, and I-s is a mutant LacI that cannot bind lactose.

16. I+ P+ O+ Z+ Y+ 17. I- P+ O+ Z+ Y+ 18. I-S P+ O+ Z+ Y-/ I+ P+ O+ Z- Y+ 19. I+ P+ O- Z- Y+ / I+ P+ O+ Z+ Y- 20. I- P+ O- Z+ Y- / I+ P+ O+ Z- Y+ 21. I-S P+ O+ Z+ Y- / I+ P+ O- Z+ Y+ 22. I-S P+ O- Z+ Y+ 23. I+ P- O- Z+ Y- / I+ P+ O+ Z- Y+ 24. I+ P- O+ Z+ Y- / I+ P+ O- Z- Y+ 25. I- P+ O+ Z+ Y- / I+ P- O+ Z- Y+

For questions 26-35 answer A. Increase B. Decrease C. Stay the same. For questions 26-29, You have generated reporter gene constructs that have a promoter driven by CRE elements. What would happen to levels of the reporter if you mutated or altered the cells in the following manner? 26. You treat the cells with a drug that inhibits the degredation of cAMP. 27. You treat the cells with a drug that prevents cAMP from binding to PKA, but does not alter PKA in any way. 28. You mutate the CREB such that is always dimerizes, whether phosphorylated or not 29. You mutate adenylyl cyclase such that is can no longer bind G-proteins.

For questions 30-35 you generate a reporter gene construct driven by a transcription factor that is activated by phosphorylation by ERK. What would happen is you mutated or altered the cells in the following ways? 30. You treat the cells with a mutant growth factor that can no bind to the growth factor receptor. 31. You treat the cells with a drug that inhibits receptor tyrosine kinase activity. 32. You mutate RAS such that it loses GTPase activity but retains all other functions. 33. You mutate MEK such that is active, whether or not it is phosphorylated. 34. You express a version of the receptor that dimerizes without growth factor. 35. You mutate GRB2 such that is can no longer bind to SOS.

36. In the PKA-CREB pathway, the GEF is the ______, while in the RTK pathway the GEF is called ____? A. Adenylyl Cyclase - RAF B. cAMP - SOS C. PKA - RAS D. Receptor - SOS E. Receptor – Receptor

37. Which amino acid would you expect a tRNA with the anticodon 5-CUU-3 to carry? The genetic code is given in question 47. a. lysine b. glutamic acid c. leucine d. phenylalanine e. alanine

38. Leucine zippers are A) dimerization motifs found within transcription factors that contribute to combinatorial interactions B) located in the C-terminus of splice factors and are used to help dock to pre-mRNAs C) held together with 4 cysteine residues D) all of the above E) a and b only

39. When Iron concentration is high, IRP will dissociate form the 3’ UTR of the transferrin receptor mRNA. IRP would also do which of the following? A. dissociate from the 5’UTR of the transferrin receptor mRNA B. dissociate from the 5’UTR of the ferritin mRNA C. associate with the 3’UTR of the ferritin mRNA D. More than one of the above E. None of the above

40. In mammalian cells promoters that contain highly methylated CpG-rich regions are most likely to be: A. Transcriptionally silent B. Exhibit an open chromatin structure C. translationally active D. all of the above E. a and b only

41. Phosphorlyation of eIF2 alpha. A. stimulates translation B. inhibits protein synthesis C. activates transcription D. inhibits transcription E. inhibits the PKA pathway

42. Which of the following is incorrect regarding the glucocorticoid hormomes? A. They interact with receptors located in the plasma membrane of the cell B. After glucocorticoid interacts with the receptor, HSP90 is released C. The receptors form a homodimer that travels to the nucleus D. The homodimer interacts with GRE, activating transcription E. An activated glucocorticoid receptor drives expression of multiple genes

43. Which of the following mRNAs would be found at the lowest concentration? A. 5' GGAUGGCCGUUUGAAAAAAAAAAAAAAAAAAAAA 3' B. 5' GGAUGGCGACCUGAAUUUAAUUUAAUUUAAAAAA 3' C. 5' GGAUGGAAGUUUGAAUUUAAUUUAAAAAAAAAAA 3' D. 5' GGAUGGGGACUUGAAUUAAAAAAAAAAAAAAAAA 3'

44. In a cloning experiment, you use a vector that contains a lacZ gene as a selectable marker. If the competent cells are grown on X-Gal and IPTG, which colonies would contain recombinant DNA inserted into the plasmid? A. The white colonies B. The blue colonies C. Half the total colonies D. None of the colonies

45. Eukaryotic gene transcription can be repressed by A. DNA methylation B. Histone acetylation C. Histone deacetylation D. Both A and B E. Both A and C

Explanation / Answer

1) Translation is terminated in eukaryotes when ribosome reaches the end of stop codon and when no charged tRNA are present, then premature termination occur.

2) Lysogenic to lytic cycle shift is needed to kill the host. Lytic cycle will lyse the host for the release of virions so that they can infect new cells.

3) None of tha above

37) 5'CUU3' tRNA will bind to 5'AAG 3' codon which is Lysine

44) Cells transformed with vectors with recombinant DNA will produce white colonies and cells with only vector non recombinant plasmids produce blue colonies.When lacZ is present (no insert) then the B galactosidase will cleave the X gal and produce blue colonies. When insert is present, the lacZ is disrupted and hence it produce white colonies.

45) Histone acetylation leads to acitvation of transcription by relaxing the condensed chromosomes. Histone deacetylation condense chromosomes and repress transcription. DNA methylation repress gene transcription. SO the answer is Both A and C

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.