CAU ALu GCU GAU Guc Goc GUG GCG? 8. The sequence Use the information below and t

Question

CAU ALu GCU GAU Guc Goc GUG GCG? 8. The sequence Use the information below and the table of codons to answer questions 17 and 1 below represents the initial regions of normal hemoglobin beta chain, which is mutated in sickle cell anemia. In the Cameroon variant of sickle cell anemia, the glutamic acid at position 7 is mutated to a valine (E7V). The sequence is shown starting with the initiation codon. ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTG AACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAG 16. The most likely single-base mutation at the DNA level leading to this pathogenic variant is: A) GAG to GTG B) GAG to GCG C) GAG to GGG D) GAG to GAC E) GAG to GUG

Explanation / Answer

16- In the given problem Glutamic acid is mutated into valine

GUG codes for valine.

So the answer is option E. GAG to GUG mutation

17- Glutamic acid is an acidic amino acid and in its R-group it has COO- group which provide haemoglobin negative charge. Due to mutation, a negatively charged polar amino acid is converted into non-polar amino acid.

So the answer is option B.

18 - As we can see from the codon table that there are 64 codons out of which 61 codes for amino acid and 3 codons are stop codon which helps in termination of translation.

Hence answer is option E- 64

19 -

All the options are correct except option E. mRNA has the codes for an amino acid that has to be added during the translation.

So the answer is option E.

20 - Translation inside the cells takes place in the cytoplasm. A protein that needs to be secreted are first synthesis in the cytoplasm, then their sequence is recognized by some special protein which then transfers the synthesizing peptide to the rough endoplasmic reticulum.

Hence answer is option - B. The rough ER

Related Questions

Navigate

• Browse (All)
• Browse C
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.