You are a forensic detective for the local police department. Your field detecti

Question

You are a forensic detective for the local police department. Your field detectives bring you a DNA sample from a crime scene. They have also identified four suspe based on traditional detective work, and have obtained a DNA sample from each suspect. The field detectives have no idea how to figure out which suspect DNA matches the DNA found at the crime scene--but you do You process the samples and obtain the genotypes at three loci (or locations) that have tandem repeats Here is the results from the DNA found at the crime scene STR site1 STR site 2 STR site 3 ATAGATAGATAGATAGATA ATTCGATTCGATTCGATTCGATTCGATTCGATTCGGCCGCCGCCGCCGCGC Which of the suspects DNA (below) matches the DNA found at the crime scene? O STR site 1 STR site 2 STR site 3 GATAGATAGATAGATAGATA ATTCGATTCGATTCGATTCGATTCGATTC GCCGCCGCCGCCGCC O STR site 1 STR site2 STR site 3 GATAGATAGATAGATAGATA ATTCGATTCGATTCGATTCGATTCGATTCGATTCG GCCGCCGCCGCCGCC O STR site 1 STR site 2 STR site3 GATAGATAGATAGATA ATTCGATTCGATTCGATTCGATTCGATTCGATTCG O STR site 1 STR site 2 STR site 3 GATAGATAGATAGATAGATAGATAGATA ATTCGATTCGATTCGATTCG GCCGCCGCCGCCGCCGCCGCC Click Save and Submit to save and submit. Click Save All Answers to save all answers ave Save and Submit

Explanation / Answer

Answer: Option B is correct.

Explanation:
Crime scene sample:
STR 1 = 5 GATA repeats
STR 2 = 7 ATTCG repeats
STR 3 = 5 GCC repeats (modification at the end)

Option B STR analysis:
STR 1 = 5 GATA repeats
STR 2 = 7 ATTCG repeats
STR 3 = 5 GCC repeats (modification at the end)

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.