Question 5: PCR, 5 points Imagine you want to amplify the 500 bp in the black bo

Question

Question 5: PCR, 5 points Imagine you want to amplify the 500 bp in the black box. You are unsure of the sequence in the black box, but you know with certainty the sequence of flanking DNA, as shown. atggtgeccctcogagtttgcgtgctgccctgtggaggtt 500 bp. attctaatcttccaaggttacagctegagete taagattagaaggttccaatgtegagetcgag taccacggegagcctcaaacgcacgacgggacacctccaa A. 2.5 points. Design a 20 bp primer to amplify the top strand. Label the 5' and 3' ends of your primer B. 2.5 points. Design a primer to amplify the bottom strand. Label the 5' and 3' ends of your primer

Explanation / Answer

A.
If we want to amplify the top strand, the primer has to anneal to the bottom strand so that the newly synthesized strand is same as the top strand.

The primer that binds to the bottom strand is the reverse primer (We should consider strand orientation)

Reverse primer: 5'-CAAACTCCGAGGGGCACCAT-3'

B.
If we want to amplify the bottom strand, the primer must anneal to the top strand so that the newly synthesized strand is same as the bottom strand.
Forward primer: 5'-CAAGGTTACAGCTCGAGCTC-3'

Related Questions

Navigate

• Browse (All)
• Browse Q
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.