You have the following sequence reads, from a genomic done of the Homo sapiens g

Question

You have the following sequence reads, from a genomic done of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2; AAGAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAG ATGCGATCTGTGAGGCGAG Read 4: TGTCTGCCATTC1TAAAAACAAAAATGT Read 5: T GTTATTTTT ATTTCAGATOCGA Read 6: AACAAAAATGTTGTTATT Use these six sequence reads to create a sequence contig of this part of the H. sapiens genome. Translate the sequence contig in all possible reading frames. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (http//www.ncbi.nim.nih.gov/BLAST/,and see Appendix B), and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for protein-protein comparison (BLASTp).

Explanation / Answer

a. just align them. for example, read 2 and read 6 are already aligned. read 5 goes towards the end of those two aligned, and read 4 might go before the two already aligned. T G T C T G C C A T T C T T A A A A A C A A A A A T G T T G T T A T T T T T A T T T C A G A T G C G A T C T G T G A G C C G A G T C T T T A b. there are 6 possible reading frames. see: http://www.alterorf.cl/faq/definicion.jp… c. blast website: http://blast.ncbi.nlm.nih.gov/ (or more specifically, go to http://www.ncbi.nlm.nih.gov/genome/seq/B… ) put in your assembled sequence and hit search to find your sequence to find: http://www.ncbi.nlm.nih.gov/nuccore/2245…

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.