Question 5 5.1 Given the sequence of a portion of a bacterial gene below: 5’GTAT

Question

Question 5
5.1 Given the sequence of a portion of a bacterial gene below:
5’GTATCGTATGCATGCATGCATCGTGAC’3
3’CATAGCATACGTACGTACGTAGCACTG’5
The template strand is on the bottom.
5.1.1 Assuming that transcription starts with the first T in the template strand, and
continues to the end, what would be the sequence of the mRNA derived from
this fragment?
5.1.2 Find the initiation codon in this mRNA.
5.1.3 Would the1re be an effect on translation of changing the G in the template
strand to C if so, what effect?
5.1.4 Would there be an effect on translation of changing the last T in the template
strand to C? if so what effect?
5.1.5 Would there be an effect on translation of changing the last T in the template
strand to G? if so what effect?

Explanation / Answer

Ans) The information about the amino acid sequence of a protein is located in the DNA. All the proteins which expressed in a cell are coded by the genes which are present in DNA. The RNA polymerase bind to the promoter sequences of DNA and copy the genetic information present in DNA into mRNA by Transcription processes and then ribosome's translate this information located in mRNA (in the form of codons) as a protein by a process called translation. The template DNA strand or negative strand or nonsense strand of DNA is complementary to mRNA. The RNA polymerase binds to the promoter region which is located at an upstream portion of a gene and initiates the synthesis of mRNA by denovo fashion. From the transcription bubble (DNA-RNA hybrid), 5 end of mRNA is released into cytoplasm during transcription processes. The ribosomes bind to mRNA and initiate translation. The first codon on mRNA to be translated is AUG (initiation codon) and it codes for formyl methionine in prokaryotes but in eukaryotes it is methionine. Once the synthesis of protein initiated from the AUG codon it will translate mRNA until it reaches the stop codon (UAA, UAG, UGA). The stop codons will not code for any amino acids and translation processes terminated.

5’-GTATCGTATGCATGCATGCATCGTGAC-3’

3’-CATAGCATACGTACGTACGTAGCACTG-5’                        (template DNA strand or negative strand)

5.1.1 Assuming that transcription starts with the first T in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?

3’-CATAGCATACGTACGTACGTAGCACTG-5’                        (template DNA strand or negative strand)

5’-UAGCAUACGUACGUACGUAGCACUG-3’ (mRNA to be transcribed)

5.1.2 Find the initiation codon in this mRNA.

Initiation codon is not observed in the mRNA produced by the template DNA strand given in the above-mentioned problem.

5.1.3 Would there be an effect on translation of changing the G in the template strand to C if so, what effect?

3’-CATAGCATACGTACGTACGTAGCACTG-5’           (template DNA strand or negative strand)

3’-CATACCATACCTACCTACCTACCACTC-5’ (G to C replaced template DNA strand)

5’-CAUACCAUACCUACCUACCUACCACUC-3’        (mRNA to be transcribed after G to C conversion)

There is no effect on translation of mRNA but in mRNA, the codons for the amino acids Isoleucine, serine, arginine, valine, alanine are replaced by the Tyrosine, Isoleucine, proline, leucine, proline codons.

HSI RTY VAL           protein synthesized before conversion (serine, Isoleucine, arginine, valine alanine)

HTI PTY LPL           protein synthesized after conversion (Tyrosine, Isoleucine, proline, leucine, proline)

5.1.4 Would there be an effect on translation of changing the last T in the template strand to C? if so what effect?

3’-CATAGCATACGTACGTACGTAGCACTG-5’            (actual template DNA strand or negative strand)

3’-CATAGCATACGTACGTACGTAGCACCG-5’            (the last T to C replaced template DNA strand)

5’-CAUAGCAUACGUACGUACGUAGCACCG-3’ (mRNA to be transcribed after the last T to C conversion)

There is no effect on translation of mRNA but in mRNA, the codon for the amino acid leucine is replaced by proline codon.

HSI RTY VAL                       protein synthesized before conversion (leucine)

HIS RTY VAP                       protein synthesized after conversion (proline)

5.1.5 Would there be an effect on translation of changing the last T in the template strand to G? if so what effect?

3’-CATAGCATACGTACGTACGTAGCACTG-5’            (actual template DNA strand or negative strand)

3’-CATAGCATACGTACGTACGTAGCACGG-5’           (the last T to G replaced template DNA strand)

5’-CAUAGCAUACGUACGUACGUAGCACGG-3’ (mRNA to be transcribed after the last T to G conversion)

There is no effect on translation of mRNA but in mRNA, the codon for the amino acid leucine is replaced by Arginine codon.

HSI RTY VAL                       protein synthesized before conversion (leucine)

HIS RTY VAR                      protein synthesized after conversion (Arginine)

Related Questions

Navigate

• Browse (All)
• Browse Q
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.